We narrowed to 3,178 results for: val
-
Plasmid#105857PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG1-derived CH2.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG3 with CH2 derived…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pGL4.23 A82V/T230A/D637G 2014 EBOV + Mucin-Like Domain
Plasmid#86020PurposeEbola Virus (Makona) Glycoprotein in CMV driven mammalian expression vectorDepositorInsertMakona Ebola Virus Glycoprotein
ExpressionMammalianMutationChanged alanine 82 to valine, threonine 230 to al…PromoterCMV IEAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PMVK
Plasmid#20593DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
-
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-FUSN-VP16
Plasmid#183933PurposeOptogenetic PHR domain coupled to GFP, FUSN (high phase separation propensity) and VP16 activation domain; binds to CIBN upon blue light exposureDepositorExpressionMammalianMutationnonePromoterCMVAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSin-EF2-DMD53-GFP
Plasmid#138353PurposeExpressing a GFP reporter cassette, whose GFP reading frame is disrupted by insertion of partial DMD exon 53 sequencesDepositorInsertDMD exon 53 partial sequence to disrupt GFP reading frame (DMD Human)
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterEF2Available SinceNov. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_CH1h-1
Plasmid#105856PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG1-derived CH1 and hinge.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG3 with CH1 and hin…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH2-3
Plasmid#105851PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG3-derived CH2.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG1 with CH2 derived…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH1h-3
Plasmid#105850PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG3-derived CH1 and hinge.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG1 with CH1 and hin…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAED2
Plasmid#234599PurposeFluorescent reporter of the SOS responseDepositorInsertsmScarlet-I
gfp-mut2
UseReporterExpressionBacterialMutationGFPmut2 was derived from avGFP with the following…PromoterPtet+dnaK P1 and cdaAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPMEL-hbb
Plasmid#239863PurposeTemplate for in vitro transcription of PMEL (gp100), including native signal peptide, flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertFull premelanosome coding sequence including native signal peptide, flanked by human haemoglobin beta 5' and 3' UTRs (PMEL Human)
ExpressionMammalianMutationValine to Glycine change is at amino acid 26 of n…PromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_VPEVS
Plasmid#105863PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_ILGGP
Plasmid#105855PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p3X-UASTattB
Plasmid#189859PurposeFly cloning and transformationDepositorTypeEmpty backboneExpressionInsectAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2X-UASTattB
Plasmid#189860PurposeFly cloning and transformationDepositorTypeEmpty backboneExpressionInsectAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTD68-rHUH
Plasmid#235194PurposeTo express rHUH-myc in bacteriaDepositorInsertrHUH
ExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJKW0825
Plasmid#119022PurposeE.coli expression plasmid for Pm4CL1DepositorInsertPm4CL1
Tags8xHisExpressionBacterialPromoterT7Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORFE0010
Plasmid#112074Purpose3xmVenus module CTDepositorInsert3xmVenus
ExpressionPlantMutationSer to Thr at amino acid 63 and Phe to Leu at pos…Available SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only