We narrowed to 27,149 results for: RON
-
Plasmid#122103PurposeAAV-mediated expression of Chronos-tdTomato under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
p13xLexAOP2-IVS-Syn21-Voltron-p10
Plasmid#119042PurposeLexAop2-driven expression of Voltron in DrosophilaDepositorInsertVoltron
ExpressionInsectPromoterhsp70Available SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBT250_(pCA-G-intron(Neo)-tTA2)
Plasmid#36876DepositorInsertsGFP
tTA2
beta-globin intron
Neo
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBT241_(pCA-ATG-intron-tTA2)
Plasmid#36875DepositorInserttTA2
ExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated V1 O-Glycosylation site
Plasmid#120406Purposeenables eukaryotic expression of human plasma fibronectin in which the third O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with a mutation…PromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dox human Citron shRNA 1 mKate
Plasmid#155293PurposeLentivirus for doxycycline inducible expression of nontargeting shRNA, mKate marker, based on Addgene 11652DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
B. thetaiotaomicron mRNA toehold switch sensor
Plasmid#110707PurposeToehold switch sensor to detect a species specific mRNA with GFP outputDepositorInsertB. thetaiotaomicron species specific toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
RON2-COMP-blac-flag-his
Plasmid#110962PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertrhoptry neck protein 2 (RON2) (PF3D7_1452000 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-aSYNUCLEIN WT
Plasmid#247940PurposeAAV transfer plasmid encoding the human α-SYN under the control of the CMVie enhanced synapsin1 promoterDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdDronpa1.2-Talin1(1974–2541)-mIFP
Plasmid#249168PurposeMammalian expression vector of talin1 C-terminal fragment fused with pdDronpa1.2DepositorInsertTalin1 (TLN1 Human)
TagsmIFP and pdDronpa1.2ExpressionMammalianMutationDeleted amino acids 1–1973PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-DjCas13d-pA
Plasmid#192498PurposeTo express DjCas13d in a Cre dependent mannerDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSA358_pAAV-SCP1-Intron-eGFP-CS1
Plasmid#215513PurposeSingle stranded AAV eGFP reporter vector with SCP1 promoter.DepositorInserteGFP
UseAAVExpressionMammalianPromoterSCP1Available SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG3831_pGEEC579_pShip-UbC(no_intron)-mRuby2-bGH
Plasmid#239742PurposePlasmid expressing mRuby from a UbC promoter lacking an intron, used for modRNA productionDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG3774_pGEEC580_pShip-EF1a(no_intron)-mRuby2-bGH
Plasmid#239743PurposePlasmid expressing mRuby from an EF1a promoter lacking an intron, used for modRNA productionDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-ER WPRE
Plasmid#236230PurposeAAV expression of a fluorescent marker, mEmerald fused to Prolactin signal peptide and KDEL sequence; for expression and retention in the lumen of the endoplasmic reticulumDepositorInsertmEmerald-PRL signal peptide-KDEL sequence (PRL Bovine)
UseAAVTagsmEmeraldPromoterhuman Synapsin 1Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-RBD Omicron XBB.1.5
Plasmid#214724PurposeExpresses SARS-CoV-2 Omicron XBB.1.5 RBD (receptor-binding domain from Spike) with N-terminal SpyTag fusion in mammalian cellsDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-tubgenomic-PTC62-deltaIntron3_D
Plasmid#146146PurposeMammalian Expression of tubgenomic-PTC62-delIntron3DepositorInserttubgenomic-PTC62-delIntron3
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2365 - Intron GG1 - 250bp no PATC
Plasmid#159883PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG1 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2345 - Intron GG2 - 250bp no PATC
Plasmid#159884PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG2 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only