We narrowed to 20,112 results for: IRE
-
Plasmid#68878PurposeTransient mammalian expression of CHD5 for BirA taggingDepositorAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pDestTol2-actinb-kcnj10a-IRES-EGFP
Plasmid#164947PurposeTol2 construct: actinb (actb2) promoter driven zebrafish kcnj10a and EGFPDepositorInsertkcnj10a (kcnj10a Zebrafish)
UseTol2 transposon destination vectorTagsIRES-EGFPPromoteractinb (actb2) promoterAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLE1 C-ISCmut
Plasmid#160804PurposeExpress C-terminal ISC mutant POLE1DepositorInsertPOLE1 C-ISCmut (POLE Human)
UseRetroviralTags3xFLAGMutationshPOLE_1 and shPOLE2 resistant, C2221S, C2224S, C…Available SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-myc-LRH1(ES)-IRES-neo
Plasmid#28092DepositorAvailable SinceApril 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCru5-/UAA-mEGFP-IRES-mCherry
Plasmid#49225PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
b2AR->M71-IRES-tauGFP-ACNF TV
Plasmid#105198Purposetargeting vector to generate a replacement of CDS of M71 with CDS of mouse beta2-adrenergic receptor with expression of tauGFP.DepositorAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Fbxo7(ΔF-box)-IRES-GFP
Plasmid#171787Purposeretrovirus productionDepositorAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS507-pCDest2-noAcr-mTagBFP2-IRES
Plasmid#85748PurposeExpresses mTagBFP2 only; used as a controlDepositorInsertmTagBFP2
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQC hKGA.wt V5-His IRES G418
Plasmid#110390Purposeγ-Retroviral transfer vector for expressing glutminase isoform KGA (wild type), C-terminal V5-6xHis tags, IRES-driven Geneticin selection.DepositorInsertKGA glutaminase (GLS Human)
UseRetroviralTags6xHis and V5ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ki67 (shuffled Nterm)-mNeonGreen-IRESpuro2
Plasmid#183744PurposeExpresses Ki67 (shuffled Nterm)-mNeonGreenDepositorInsertMKI67 (shuffled Nterm) (MKI67 Human)
TagsmNeonGreenExpressionBacterial and MammalianMutationCD domain with shuffled 4 fragments fused to the …PromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV-EVA1ext-hFcIgG3-IRES-YFP
Plasmid#64926PurposeTo express extracellular portion of EVA1 (mouse) fused with human Fc(IgG3)DepositorUseRetroviralTagsIRES-YFPExpressionMammalianPromoterLTRAvailable SinceJune 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLEX-MAPKAP1Del-FHH-IRES-Puro
Plasmid#120706PurposeExpresses MAPKAP1 Truncation-Flag-HA-6xHIS fusion protein in mammalian cells & for virus productionDepositorInsertMAPKAP1 Isoform 1
UseLentiviralTagsFlag-HA-6xHISExpressionMammalianMutationDeleted amino acids 193-522PromoterCMVAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2B IRES GFP
Plasmid#133817PurposeEncodes the C2B domain of synaptotagmin 1 for viral expressionDepositorAvailable SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-bat-Caspase-4
Plasmid#183377PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-4
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα-RIIαWT-IRES-EGFP
Plasmid#183456PurposeReplacement of endogenous rat PKA-RIIα subunits with wild-type RIIαDepositorInsertsgRNA and Prkar2a (Prkar2a Rat)
UseLentiviralMutationshRNA-resistant mutations: C135>G, G138>A, …PromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
hPlekhm1-N/pIRES puro Glue (M1-A497)
Plasmid#73454PurposeExpress human N-terminal part (M1-A497) Plekhm1 in mammalian cellsDepositorAvailable SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-pax3a-kcnj13-IRES-EGFP
Plasmid#164950PurposeTol2 construct: pax3a-5.4k promoter driven zebrafish kcnj13 fused with EGFP and EGFPDepositorInsertkcnj13 (kcnj13 Zebrafish)
UseTol2 transposon destination vectorTagsIRES-EGFPPromoterpax3a promoter -5.4kAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-actinb-kcnj13-IRES-EGFP
Plasmid#164941PurposeTol2 construct: actinb (actb2) promoter driven zebrafish kcnj13 and EGFPDepositorInsertkcnj13 (kcnj13 Zebrafish)
UseTol2 transposon destination vectorTagsIRES-EGFPPromoteractinb (actb2) promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Drd1a->M71-IRES-tauGFP ACNF TV
Plasmid#105073PurposeTargeting vector: the coding sequence of M71 is replaced by the sequence encoding amino acids 1-447 of Drd1a and an IRES-tauGFP followed by ACNF cassetteDepositorUseMouse TargetingMutationDrd1a coding sequence followed by IRES-tauGFP ACNFAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only