We narrowed to 2,609 results for: ERK
-
Plasmid#209127PurposeLentiviral vector including gene for CC-GEMS ligand SUMO-A'-l4-G' and EmGFPDepositorInsertSUMO-A'-l4-G'-IRES-EmGFP
UseLentiviralExpressionMammalianAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-SUMO-A'-l4-G-IRES-EmGFP
Plasmid#209126PurposeLentiviral vector including gene for CC-GEMS ligand SUMO-A'-l4-G and EmGFPDepositorInsertSUMO-A'-l4-G-IRES-EmGFP
UseLentiviralExpressionMammalianAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSRW1JZ
Plasmid#129528PurposeC. elegans codon-optimized FlincG3 (GFP-based cGMP sensor) expressed in C. elegans ASE neuron pairDepositorInsertFlincG3
ExpressionWormAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV FLIPi P2G_Thy1.1 Dbl (p53,PTEN)
Plasmid#19746DepositorInsertoligo targeting p53 and PTEN (Pten Mouse)
UseCre/Lox, RNAi, and RetroviralExpressionMammalianAvailable SinceDec. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-EGFP-CLASP2 340-1084
Plasmid#24383DepositorInsertCLASP2 (340-1084) (CLASP2 Human)
UseAdenoviralTagsEGFPExpressionMammalianMutationCLASP2 deletion mutant that retains MT lattice bi…Available SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
FL MALT1 Catalytic Mutant in pET29b-Strep
Plasmid#48969PurposeExpresses Full length catalytic mutant MALT1 in e.coliDepositorInsertMALT1 isoform A (MALT1 Human)
TagsHis and StrepExpressionBacterialMutationCatalytic Mutant C464APromoterT7Available SinceNov. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
HS-DN-Cep152-mKate2
Plasmid#105943Purposeheat shock inducible transgenesisDepositorAvailable SinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET21 Catalytic Domain of MALT1 Catalytic Mutant
Plasmid#48971PurposeExpresses catalytic domain of MALT1 catalytic mutant in e.coli AA 329-566DepositorInsertMALT1 (MALT1 Human)
TagsHisExpressionBacterialMutationContains AA 329-566; Catalytic Mutant C464APromoterT7Available SinceOct. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 PARL-FLAG-CT H335G
Plasmid#13749DepositorTagsFLAGExpressionMammalianMutationChanged catalytic His 335 to GlyAvailable SinceFeb. 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-TBX1wt-IDR
Plasmid#145254PurposeExpresses fusion of GAL4 DNA-binding domain and TBX1wt IDRDepositorInsertTBX1wt-IDR (TBX1 Human)
ExpressionMammalianAvailable SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAdEasy-EGFP-CLASP2 340-1362 9xS/A
Plasmid#24523DepositorInsertCLASP2 (340-1362) 9xS/A (CLASP2 Human)
UseAdenoviralTagsEGFPExpressionMammalianMutationNonphosphorylatable CLASP2 deletion mutant. M…Available SinceJuly 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_H2B-SiR-tag-T2A-mEGFP
Plasmid#249668PurposeCo-expression of silicon rhodamine-binding protein tag (nuclear) and mEGFP (not localized) in mammalian cellsDepositorInsertH2B-SiR-tag-T2A-mEGFP
ExpressionMammalianAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only