We narrowed to 28,941 results for: Tat
-
Plasmid#116835PurposeLentiviral expression of QKI__PACRG fusionDepositorInsertQKI__PACRG
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CDK6__HEPACAM2
Plasmid#116812PurposeLentiviral expression of CDK6__HEPACAM2 fusionDepositorInsertCDK6__HEPACAM2
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-DUSP22__PTK7
Plasmid#116814PurposeLentiviral expression of DUSP22__PTK7 fusionDepositorInsertDUSP22__PTK7
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-GSK3A__ZNF564
Plasmid#116820PurposeLentiviral expression of GSK3A__ZNF564 fusionDepositorInsertGSK3A__ZNF564
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IDE__CAMK1D
Plasmid#116823PurposeLentiviral expression of IDE__CAMK1D fusionDepositorInsertIDE__CAMK1D
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IKBKB__ANK1
Plasmid#116824PurposeLentiviral expression of IKBKB__ANK1 fusionDepositorInsertIKBKB__ANK1
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-MAP2K5__IQCH
Plasmid#116826PurposeLentiviral expression of MAP2K5__IQCH fusionDepositorInsertMAP2K5__IQCH
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_CH2charge
Plasmid#105858PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutatnions modify charge of CH2 domain.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3, muatations: Hi…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
xCIAR_pcDNA5/FRT/TO
Plasmid#86504PurposeExpresses inactive control CIAR (xCIAR) in mammalian cells. Used to generate Flp-In stables.DepositorInsertxCIAR (SOS1 Human)
UseFrtExpressionMammalianMutationF929A and T968L in SOScatPromoterCMV (tet operator)Available SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100L-siResist
Plasmid#49854PurposeEncodes human connexin 43 with M100 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100 mutated to Leucine. Contains severa…PromoterCMVAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-ADAM29 (E111K)
Plasmid#31144DepositorInsertADAM29 (ADAM29 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationGlutamic acid 111 changed to LysineAvailable SinceSept. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/D614G
Plasmid#164566PurposeSARS-CoV-2 Spike protein with D614G mutation (S-GSAS-D614G variant)DepositorInsertSpike (S-GSAS-D614G variant)
Tags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
IL6R PLAK1
Plasmid#161518PurposeExpresses IL6 receptor (full length) in mammalian cells.DepositorInsertInterleukin 6 Receptor (IL6R Human)
UseLentiviralAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSynSRE-Mut-T-Luc
Plasmid#60490PurposeContains a mutant version of the WT pSynSRE-T-Luc reporter plasmid. Four point mutations in the promoter SRE elements abolish SREBP-induced luciferase expression as described by Smith et al., 1988DepositorInsertHMG-CoA synthase promoter (-324/-225) fused to HMG-CoA synthase TATAA (-28/+39) transcription initiator sequence
UseLuciferaseTagsLuciferase reporterExpressionMammalianMutationFour point mutations (G->C or A->C) in the …PromoterPartial HMG-CoA synthase promoter (-324/-225) fus…Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 1 tet pLKO puro
Plasmid#162985PurposeTet-inducible shRNA targeting human METTL3 #1DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-RAD50
Plasmid#116784PurposeLentiviral expression of RAD50DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ROR1
Plasmid#116789PurposeLentiviral expression of ROR1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-VLDLR
Plasmid#116802PurposeLentiviral expression of VLDLRDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTCH1
Plasmid#116779PurposeLentiviral expression of PTCH1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only