We narrowed to 8,859 results for: sgRNA
-
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pW188-lenti-spsgRNA-lacZ-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170813PurposeLentiviral vector to co-express a lacZ control spsgRNA with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNA
Plasmid#61593PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTagsHA, NLS, and OLLAS tagExpressionMammalianMutationK175R and K736R (deUb mutations)Available SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLQ9834_sgBB: pHR-hU6-CasMINI sgRNA_#2; EF1a-Puro-T2A-BFP- WPRE
Plasmid#180280PurposeThe CasMINI sgRNA cloning backbone with sites 'BsmBI' for inserting new guide sequences.DepositorInsertCasMINI sgRNA (backbone) and BFP
UseLentiviralExpressionMammalianPromoterU6Available SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR
Plasmid#60231PurposeExpresses Cre recombinase and KASH-tagged EGFP from the hSyn promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Cre recombinase
EGFP
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HA-P2A and EGFP-KASHExpressionMammalianPromoterU6 and hSynAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR
Plasmid#60230PurposeExpresses Cre recombinase and KASH-tagged EGFP from the hSyn promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Cre recombinase
EGFP
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HA-P2A and EGFP-KASHExpressionMammalianPromoterU6 and hSynAvailable SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCC_02 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9NG-NLS-2A-Puro-WPRE
Plasmid#139087PurposeExpresses human codon-optimized Cas9-NG nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertSpCas9-NG
UseCRISPR and LentiviralExpressionMammalianMutationL1111R, D1135V,G1218R, E1219F, A1322R, R1335V, T1…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCC_04 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-xCas9NG-NLS-2A-Puro-WPRE
Plasmid#139089PurposeExpresses human codon-optimized xCas9-NG nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertxCas9-NG
UseCRISPR and LentiviralExpressionMammalianMutationA262T,R324L, S409I, E480K, E543D, M694I, L1111R, …Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pW267-lenti-spsgRNA-hsCDH1-sg1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170816PurposeLentiviral vector to co-express a human CDH1 spsgRNA (sg1-Cdh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCC_01 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9-NLS-2A-Puro-WPRE
Plasmid#139086PurposeExpresses human codon-optimized SpCas9 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertSpCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B270 (plasmid expressing ATP1A1 sgSTOP and containing an empty sgRNA-expression cassette)
Plasmid#100716PurposeB52 plasmid expressing ATP1A1 sgSTOP (cloned in BsmBI site) and containing an empty sgRNA-expression cassette (use BbsI for cloning)DepositorInsertsgSTOP targeting ATP1A1 (cloned using BsmBI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCC_03 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-xCas9-NLS-2A-Puro-WPRE
Plasmid#139088PurposeExpresses human codon-optimized xCas9 3.7 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertxCas9 3.7
UseCRISPR and LentiviralExpressionMammalianMutationA262T, R324L,S409I, E480K, E543D, M694I, E1219VAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-tdTomato targeting vector (compatible with CAGGS-AsCpf1-2A-GFP-U6-AAVS1-sgRNA)
Plasmid#194728PurposeAAVS1-tdTomato targeting vector, compartible with Cpf1DepositorArticleInserttdTomato
UseCRISPR; Knockin targeting plasmidAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-U6-sgRNA_NUDT5_ex4-EF1α-Cas9-NLS-FLAG-GSG-P2A-PuroR-WPRE
Plasmid#250374PurposeLentiviral expression of sgRNA against human NUDT5 exon 4 under U6 promoter and Cas9-NLS-FLAG-GSG-P2A-PuroR under EF1α core promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-Non-target sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196989PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with non-target sgRNADepositorInsertNon-Target
UseCRISPR and LentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 3- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210739PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 3DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 1- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210737PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 1DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 2- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210738PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 2DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only