We narrowed to 10,184 results for: tre promoter
-
Plasmid#154294PurposeLentiviral vector encoding FKBP12(F36V)-2xHA-OGT (Neomycin resistant) off PGK promoterDepositorInsertO-GlcNAc Transferase (OGT Human)
UseLentiviralTags2x HA and FKBP12(F36V)ExpressionMammalianPromoterPGKAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-Neo
Plasmid#99378PurposeExpresses human NEUROGENIN2 (hNGN2) and neomycin resistance gene under control of TetON promoter. 3rd generation lentiviral backbone.DepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC293 - pAAV EF1a V5-synuclein (WT)
Plasmid#60057PurposeAn AAV packaging vector that expresses wildtype alpha-synuclein under control of the EF1a promoter.DepositorAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.PAC
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-hSNCA
Plasmid#170445PurposeLentiviral vector expressing human SNCA, under control of EF1alpha promoter.DepositorAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-Dlx-SynaptoTAG
Plasmid#210729PurposeAAV vector for mapping synaptic projections. GABAergic neuron-specific Dlx promoter expresses EGFP-Synaptobrevin-2 to label synaptic terminals and Palm-tdTomato to label neuronal soma and axons.DepositorInsertEGFP-Synaptobrevin-2, P2A, Palm-tdTomato (tdTomato with Palmitoylation sequence) (Vamp2 Rat, Synthetic)
UseAAVPromoterDlxAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hMECP2-cycle3GFP
Plasmid#163706PurposepAAV plasmid for Cre-dependent expression of human MECP2 fused with cycle3 GFP under Syn promoterDepositorAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-Kir2.1MUT-P2A-EGFP
Plasmid#176279PurposeViral vector for co-expression of non-functional Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertKir2.1MUT-P2A-EGFP (Kcnj2 Mouse, Synthetic)
UseAAV and Cre/LoxTagsMycExpressionMammalianMutationGYG to AAA (aa144-146)Promoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Puro
Plasmid#186667PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, puromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Puromycin (ANKRD1 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only