We narrowed to 7,219 results for: cas9 plasmid
-
Plasmid#196253PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA for guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
GA04
Plasmid#248860PurposeRetroviral vector encoding cas9-BFP-suntag of the modified casdrop systemDepositorInsertModified casdrop component 1
UseRetroviralAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJAT31
Plasmid#204291PurposeFor inserting a phiC31 attP site. HDR integrant is marked with ie1-DsRed, which is expressed in abdomen and mouthparts. Second U6 promoter allows use of two different gRNAs in two synthesized arms.DepositorInsertie1-DsRed
UseCRISPRPromoterie1Available SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_3plus_sgRNA_ptet_pos4
Plasmid#233459PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 4, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 4, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5
Plasmid#233460PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDN-Cherry-sgRNA
Plasmid#221387Purposeepisomal (HygR), with constitutive mCherry (Psmyc) and AHT-inducible sgRNA cloning site, including Golden Gate for multiple sgRNAsDepositorInsertnone, cloning vector for introduction of targeting sequences
UseCRISPRAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-EAMP
Plasmid#138265PurposemCherry acceptor plasmid with iCas9 target site upstream of mCherry to be used in plasmid to plasmid integration reporter assay.DepositorInsertiCas9 target-mCherry
UseCRISPRExpressionMammalianPromoterEF1a-HTLVAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_3plus_sgRNA_ptet_pos5a
Plasmid#233461PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5a1
Plasmid#233462PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a1, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a1, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5a2
Plasmid#233463PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a2, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a2, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b
Plasmid#233464PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b1
Plasmid#233465PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b1, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b1, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b2
Plasmid#233466PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b2, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b2, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSB1C3-FeGFP
Plasmid#138261PurposeDonor-eGFP vector to be used in plasmid to plasmid integration reporter assay. eGFP is conditionally expressed when integrated at iCas9-sites on acceptor plasmidDepositorInserteGFP
UseCRISPRExpressionMammalianPromoterNoneAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEcgRNA
Plasmid#166581PurposeCRISPR-Cas9-assisted genome editing in Escherichia coliDepositorInsertccdB
ExpressionBacterialAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVT36b
Plasmid#184437PurposeCRISPR/Cas9 plasmid, containing ScARS, IoURA3, iCas9, RPR1’-tRNA_Leu promoter, and sgRNA scaffoldDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRGEB33
Plasmid#158151PurposeConstruction of inPTG-Cas9 plasmids expressing gRNA within an engineered intron for binary vector plant genome editing.DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYZ033
Plasmid#98404PurposeEntry vector for S. pombe CRISPR-Cas9 system. The gRNA can be integrated easily through Gibson Assembly with the plasmid backbone digested by Not1DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only