We narrowed to 5,265 results for: crispr cas9 expression plasmids
-
Plasmid#115665PurposePiggybac transposon plasmid for destabilized eGFP (GFPd2)DepositorInsertGFPd2
UseSynthetic BiologyTagsDestabilizationExpressionMammalianPromoterCAGAvailable SinceFeb. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAS_sfGFP150K
Plasmid#193313PurposepAS control plasmid for sfGFP expressionDepositorInsertsuper folder GFP
ExpressionMammalianMutation150K in sfGFPPromoterEF1Available SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCJ1023
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterhuman U6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXZ13lacZalpha
Plasmid#160229Purposeplaces LacZalpha unit between Esp3I sites for better cutting of plasmid and ability to distinguish recombinants as white colonies when plated on Xgal platesDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterlacAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBK1876-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223162PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1861-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223161PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-SpCas9-HF1 (without sgRNA; with silent mutations)
Plasmid#126755PurposeExpression plasmid for human codon-optimized increased fidelity SpCas9-HF1 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertSpCas9-HF1
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
KB701: pMAGIC (L5-L4) hU6::SaCas9 gRNA scaffold; CMV promoter
Plasmid#121818PurposepMAGIC L5-L4 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and CMV promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide2
Plasmid#118159PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA2 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide3
Plasmid#118160PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA3 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGMC00018 (aka pRC0082)
Plasmid#195320PurposeMinimal plasmid backbone with multiple cloning site for HDR donor DNA constructionDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterial and MammalianAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-Cterm-mRuby3-Zeo
Plasmid#167206PurposePlasmid to clone recombination arms to create homologous recombination donor vector for C-terminal gene tagging with mRuby3 and selection with ZeocinDepositorTypeEmpty backboneUseCRISPRTagsmRuby3ExpressionMammalianAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral click editor (CE1) plasmid - LTR-pEF1a-PCV2-nCas9-EcKlenow (DRR921)
Plasmid#217798PurposeLentiviral plasmid to produce the prototypical CE1 construct (PCV2-nCas9-EcKlenow), expressed from the EF1a promoterDepositorInsertXTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR and LentiviralTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterEF1aAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSTBlue-U6-sgRNA(tdTomato)
Plasmid#47871PurposeThis plasmid contains expression cassette for sgRNA targeting tdTomato.DepositorInsertsgRNA-tdTomato
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V
Plasmid#187959PurposeExpressed ABA-inducible dimerizing KRAB-dCas9 system, with KRAB-IRES-Blasticidin resistance under CAG promoter and tagBFP-dCas9-FKBP12 (F36V mutant) degron under PGK promoter in a piggyBac plasmid.DepositorInsertsBlasticidin resistance
FKBP12_F36V
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAT007
Plasmid#171634PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting TRAC and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-TRAC
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSP2279
Plasmid#70706PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 2: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A and H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGLOW79
Plasmid#177339PurposeC. elegans mNeonGreen co-injection markerDepositorInsertPmyo-3::mNeonGreen
TagsmNeonGreenExpressionWormPromotermyo-3Available SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_antiCD19_H1_Gal4VP64
Plasmid#169918PurposeExpression of a synNotch receptor containing antiCD19, a human Notch1 core, and Gal4VP64.DepositorInsertantiCD19-Notch1-GL4VP64
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only