We narrowed to 6,001 results for: crispr cas9 expression plasmids
-
Plasmid#73721PurposeSapTrap Halotag + Cbr-unc-119 donor plasmidDepositorInsertHalotag + Cbr-unc-119
UseCRISPR and Cre/LoxTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONOR 6colors
Plasmid#229974PurposebigMamAct assembled plasmid for 6colors cellular labellingDepositorInsertmito-mCherry, EYFP-tubulin, H2B iRFP720, GTS-mTagBFP, mTFP1-actin
UseCRISPRTagsExpressionMammalianMutationSee Depositor CommentsPromoterAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
psLIB U6
Plasmid#229956PurposebigMamAct is evolution of biGBac for mammalian cells. Has empty U6-driven cassette; users should clone gene of interest into shuttle plasmid prior to multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
psLIB EF1alpha
Plasmid#229954PurposebigMamAct is evolution of biGBac for mammalian cells. Has empty EF1alpha-driven cassette; users should clone gene of interest into shuttle plasmid prior to multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
psLIB TRE
Plasmid#229955PurposebigMamAct is evolution of biGBac for mammalian cells. Has empty Tet-responsive element (TRE)-driven cassette; users should clone gene of interest into shuttle plasmid prior to Gibson cloningDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMLS292
Plasmid#73725PurposeSapTrap 2xNLS-mCherry + Cbr-unc-119 donor plasmidDepositorInsert2xNLS-mCherry + Cbr-unc-119
UseCRISPR and Cre/LoxTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
HCP8
Plasmid#166110PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets the C-terminus of Whi5DepositorInsertWhi5-sg106 (WHI5 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB8622
Plasmid#126912PurposePlasmid containing gRNA expression cassette targeting ADE2 in Saccharomyces cerevisiaeDepositorInsertADE2 gRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCJ1023
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianMutationPromoterhuman U6Available sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En01
Plasmid#71534PurposeUsed to construct a gRNA expression cassette for CRISPR/Cas9 genome editing in Marchantia polymorphaDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-ebony
Plasmid#83380PurposeDrosophila gRNA expression plasmid targets ebonyDepositorInsertebony (e Fly)
UseCRISPRTagsExpressionInsectMutationPromoterAvailable sinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
HCP9
Plasmid#166111PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets the C-terminus of Hta2DepositorInsertHta2-sg18 (HTA2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHSN6I01
Plasmid#50587PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 that is defective in DNA cleavage; the maiz…Promoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN6I11
Plasmid#50580PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSExpressionMutationdCas9 that is defective in DNA cleavage; the maiz…PromoterOsU3p and Ubi1pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN501
Plasmid#50589PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSExpressionMutationCas9D10A nickase, was derived from the zCas9 and …Promoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN501
Plasmid#50582PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Bar resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSExpressionMutationCas9D10A nickase, was derived from the zCas9 and …PromoterAtU6-26p and Ubi1pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only