We narrowed to 5,133 results for: codon optimized
-
Plasmid#104268PurposeBacterial expression of WW domain from DYSTROPHINDepositorInsertDYSTROPHIN WW domain (DMD Human)
TagsGSTExpressionBacterialMutationcodon optimized for expression in bacteriaPromotertacAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW8_yECitrine
Plasmid#110231PurposeCre/Lox C-terminal tagging construct encoding codon-optimized yellow fluorescent proteinDepositorTypeEmpty backboneUseCre/LoxAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET_His6-SUMO-TEV-TtCsm6
Plasmid#172486PurposeBacterial expression of codon-optimized His-SUMO-TtCsm6 with a TEV protease cleavage site.DepositorInsertT. thermophilus Csm6 (codon optimized) (csm6 Synthetic)
TagsHis-SUMO-TEVExpressionBacterialPromoterT7 promoter and lac operatorAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGJK_His-SUMO-LbuCas13a
Plasmid#172488PurposeBacterial expression of codon-optimized His-SUMO-LbuCas13a.DepositorInsertbdSUMO-LbuCas13a (codon-optimized)
TagsHis6 and bdSUMOExpressionBacterialPromoterT7 promoter and lac operatorAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a_His-TEV-EiCsm6
Plasmid#172487PurposeBacterial expression of codon-optimized His-EiCsm6 with a TEV protease cleavage site.DepositorInsertEnterococcus italicus Csm6 (codon optimized)
TagsHis6ExpressionBacterialPromoterT7 promoter and lac operatorAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
peGFP NOVA2 op
Plasmid#224354PurposeExpress GFP-tagged human NOVA2 (codon optimized)DepositorInsertNOVA2 (NOVA2 Human)
TagseGFPExpressionMammalianMutationcodon optimized for expression in human cellsPromoterCMV and T7Available SinceSept. 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1_SM-FLuc0-pA
Plasmid#210583PurposeExpresses SM(FLAG)-nonoptimal Firefly luciferase- pADepositorInsertSpaghetti monster (FLAG)-nonoptimal FLuc
UseLuciferaseTagsSpaghetti monster (FLAG)ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
1457_pDEST_miniTol2_R4-R2_Cryst_mCherry
Plasmid#171796PurposepDEST miniTol2-clone for R4-R2 3-component gateway assembly (p5E + pME). Include a mCherry selection marker (Crystallin promoter Lens/Eyes)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-PermE
Plasmid#209446Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning siteDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from ermE* promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV1-DIO-eGFP-pvRPL10a
Plasmid#202542PurposeCr-dependent (DIO) expression of eGFP-tagged ribosomal subunit that uses the prairie vole RPL10a gene sequence under the human synapsin promoter.DepositorInsertRPL10a subunit of the ribosome
UseAAV and Cre/LoxTagseGFPExpressionMammalianMutationoptimized for prairie vole DNA sequence and optim…Promoterhuman synapsinAvailable SinceAug. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-xF2X-P2A-Puro
Plasmid#110873PurposeLentiviral vector for constitutive expression of xFNLS in mammalian cells (codon optimized)DepositorInsertxFNLS-2X(3.7)
UseLentiviralTags3X FLAGMutationD10A, A262T, R324L, S409I, E480K, E543D, M694I, E…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-HiFi-P2A-EGFP (LM446)
Plasmid#197506PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-HiFi(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-HiFi-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-HiFi(D10A/R69…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCH1/RAD51o
Plasmid#102562PurposeExpress Human RAD51 protein codon optimzed for E.coli and the E.coli GorE OperonDepositorInsertsHomo sapiens RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) (RAD51), transcript variant 1 (RAD51 Synthetic, Human)
E. coli groE operon
ExpressionBacterialMutationCodon optimized for E.coli ExpressionPromoterT7Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-hRNF216
Plasmid#167354PurposeExpression of human RNF216 (Triad3A) codon optimized for E. coli and insect cellsDepositorInsertE3 ubiquitin-protein ligase RNF216 (RNF216 Human)
Tags3C protease cleavage site and 6x-His tagExpressionBacterialMutationcodon optimised for expression in E. coliPromoterT7Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB123 - pL0_rLUC-I (CDS1)
Plasmid#123181PurposeGolden Gate (MoClo; CDS1) compatible luciferase gene from Renilla reniformis with an intron for transient and stable expression in plantsDepositorInsertluciferase gene from Renilla reniformis with an plant intron and codon optimized for plants
UseLuciferase; Part for plant expressionExpressionPlantMutationNo BpiI and BsaI sites; codon-optimised for plantsAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-hRNF216(457-784)
Plasmid#171922PurposeExpression of human RNF216 (Triad3A) codon optimized for E. coli and insect cells. Catalytic helix-RBR-helix construct suitable for activity assays.DepositorInsertE3 ubiquitin-protein ligase RNF216 (RNF216 Human)
Tags3C protease cleavage site and 6x-His tagExpressionBacterialMutationcodon optimised for expression in E. coliPromoterT7Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-hRNF216(511-784)
Plasmid#171923PurposeExpression of human RNF216 (Triad3A) codon optimized for E. coli and insect cells. Catalytic RBR-helix construct suitable for activity assays.DepositorInsertE3 ubiquitin-protein ligase RNF216 (RNF216 Human)
Tags3C protease cleavage site and 6x-His tagExpressionBacterialMutationcodon optimised for expression in E. coliPromoterT7Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
RV-Cag-Dio-EYFP-P2A-cMaf
Plasmid#98174PurposeRetroviral vector encoding Cre-dependent expression of EYFP-P2A-MafDepositorAvailable SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-D2irTN6kwh
Plasmid#44724DepositorInsertspCMV-D2i promoter
htetR::NLS
UseSynthetic Biology; Expression regulator/reporter;…TagsRabbit β-globin intron II and WPREExpressionMammalianMutationInitiator motif (Inr) displaced relative to pCMV-…PromoterpCMV-D2iAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only