We narrowed to 2,515 results for: gcg
-
-
Tol2-LyzC-Rac-DN(guide resistant)-2a-mcherry-U6ac-Rac guides
Plasmid#168243Purpose"Dominant negative control of the assay to rescue Rac expression in neutrophil specific knockout"DepositorInsertRac(guide resistant)-DN
UseZebrafish expressionTagsmcherryPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Rac-CA(guide resistant)-2a-mcherry-U6ac-Rac guides
Plasmid#168244Purpose"Rescue Rac-CA expression in neutrophil specific knockout"DepositorInsertRac(guide resistant)-CA
UseZebrafish expressionTagsmcherryPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.4.hSyn.flex.H2B.RFP
Plasmid#170386PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+1_ATGins_Dual_pegRNA
Plasmid#173213PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +1 ATG insertion pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +1 ATG insertion pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro Cas13d-eGFP U6 RUNX1 g1
Plasmid#155185PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and RUNX1 gRNA1DepositorInsertCas13d RUNX1 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00007
Plasmid#166725Purposenon targeting sgRNADepositorInsertNon-targeting guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
CBSH3+ shRNA-2
Plasmid#160068PurposeKnock Down SH3+ Collybistin isoformsDepositorAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
-
pLG1-puro-sgATL1-2
Plasmid#109006PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN105
Plasmid#91634PurposeExpress sgRNA targeting human KCTD13DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only