We narrowed to 1,982 results for: rigi
-
Plasmid#27149DepositorInserttoll-like receptor 4(Lps) (Tlr4 Mouse)
Tags3x FLAGExpressionMammalianMutationchanged Proline 712 to Histidine. Native signal p…Available SinceFeb. 10, 2011AvailabilityAcademic Institutions and Nonprofits only -
RAMA-bio
Plasmid#47786PurposeExpresses enzymatically monobiotinylated full-length RAMA ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RAMA
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(Stop66)
Plasmid#63218PurposeExpression of a non-sense mutant version of eGFP (dark) in bacteria and in mammalian cells. Could be used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Stop66)
UseLentiviralTagsT7 and his6ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP9-bio
Plasmid#47740PurposeExpresses enzymatically monobiotinylated full-length MSP9 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP9
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
P12-bio
Plasmid#47725PurposeExpresses enzymatically monobiotinylated full-length P12 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised P12
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(W66)
Plasmid#63217PurposeExpression of the Celeste (cyan) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(W66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
CLAG3.2-bio
Plasmid#47797PurposeExpresses enzymatically monobiotinylated full-length CLAG3.2 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised CLAG3.2
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
ASP-bio
Plasmid#47745PurposeExpresses enzymatically monobiotinylated full-length ASP ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised ASP
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
RAP1-bio
Plasmid#47794PurposeExpresses enzymatically monobiotinylated full-length RAP1 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RAP1
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
H101-bio
Plasmid#47733PurposeExpresses enzymatically monobiotinylated full-length H101 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised H101
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
PTRAMP-bio
Plasmid#47793PurposeExpresses enzymatically monobiotinylated full-length PTRAMP ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PTRAMP
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYSD301
Plasmid#253031PurposeEncodes the Aga2 signal peptide, anti GFP nanobody, HA-tagged Aga2p yeast surface display anchor protein with pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast originDepositorInsertAnti-GFP nanobody -Aga2
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
aRJ_00134_PGK-mNeonGreen-syn_pA-EF1alpha-TagBFP-syn_pA
Plasmid#252538PurposeConstitutive promoters with downstream tandem syntax for PiggyBac integrationDepositorInsertTagBFP
ExpressionMammalianPromoterhEF1a (human elongation factor 1-alpha), hPGK (hu…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
aRJ_00135_EF1alpha-TagBFP-syn_pA-PGK-mNeonGreen-syn_pA
Plasmid#252539PurposeConstitutive promoters with upstream tandem syntax for PiggyBac integrationDepositorInsertTagBFP
ExpressionMammalianPromoterhEF1a (human elongation factor 1-alpha), hPGK (hu…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-Eco2
Plasmid#240681PurposeRSF1010 origin of replication plasmid containing Eco2 recombitron with a SapI flanked stuffer in the ncRNA expressed by Pm promoterDepositorInsertEco2 RT, Eco2 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNF-KB-Split PS Intein-C tTA
Plasmid#242035PurposeC-terminal segment of a blue-light-controlled split PS Intein tTA gene expression system, co-expressing mCherry under an NF-KB-inducible promoterDepositorInsertSplit PS Intein-C tTA
TagsmCherryExpressionMammalianMutationThe CMV promoter in the original vector was repla…PromoterNF-KBAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010lac-Eco1
Plasmid#240691PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010lac-Tsp1
Plasmid#240698PurposeRSF1010 origin of replication plasmid containing Tsp1 recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertTsp1 RT, Tsp1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010lac-Hcl1
Plasmid#240700PurposeRSF1010 origin of replication plasmid containing Hcl recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertHcl1 RT, Hcl1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only