We narrowed to 6,001 results for: crispr cas9 expression plasmids
-
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGRB
Plasmid#71539Purposefor expression of gRNA in E. coliDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterJ231196Available sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT1T2
Plasmid#50593PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, gRNA scaffold, OsU3t plus, TaU3p, T2
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2
Plasmid#50590PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, U626t plus, U629p, T2
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRCC-K
Plasmid#81191PurposeExpression of Cas9 and gRNA cassette in S. cerevisiae; Kan ResistanceDepositorInsertsCas9
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease see depositor comments below. and WT - cod…PromoterROX3 and SNP52pAvailable sinceSept. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRCC-N
Plasmid#81192PurposeExpression of Cas9 and gRNA cassette in S. cerevisiae; Nourseothricin ResistanceDepositorInsertsCas9
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease see depositor comments below. and WT - cod…PromoterROX3 and SNP52pAvailable sinceSept. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT3T4
Plasmid#50592PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT3, gRNA scaffold, U6-1tplus, U6-26p, T4
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSGKP-km
Plasmid#117233PurposeA sgRNA expression plasmid for genome editing in Klebsiella PneumoniaeDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT2T3
Plasmid#50591PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT2, gRNA scaffold, U6-29t plus, U6-1p, T3
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSGKP-spe
Plasmid#117234PurposeA sgRNA expression plasmid for genome editing in Klebsiella PneumoniaeDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT3T4
Plasmid#50595PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT3, gRNA scaffold, U6-26t plus, OsU3p, T4
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT2T3
Plasmid#50594PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT2, gRNA scaffold, TaU3t plus, U6-26p, T3
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRISPomyces-1
Plasmid#61736PurposeStreptomyces expression of codon-optimized Cas9, tracrRNA, and custom crRNADepositorInsertssSpCas9
tracrRNA
crRNA cassette
UseCRISPRTagsExpressionBacterialMutationBbsI-flanked lacZ cassette inserted in place of s…Promotergapdhp(EL), rpsLp(CF), and rpsLp(XC)-BbsIAvailable sinceJan. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
APq5210
Plasmid#66086Purposeco-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORFDepositorInsertsgRNA for APa4-2
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
AP303-4
Plasmid#66088Purposeco-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2DepositorInsertsgRNA for APs1
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP334-5
Plasmid#66096Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs5
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
APq5271
Plasmid#66085Purposeco-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORFDepositorInsertsgRNA for APa4-2
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
APCSD 54
Plasmid#66100Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans swan-2DepositorInsertsgRNA for CSD 54
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
APCSD 53
Plasmid#66099Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans swan-2DepositorInsertsgRNA for CSD 53
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only