We narrowed to 11,758 results for: CHL
-
Plasmid#189646Purposepsa A Left -G1397_C ABEDepositorInsertTALE and DddAtox and TadA 8e
UseTALENExpressionPlantAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTKDP-cat
Plasmid#71321PurposeDonor plasmid - chloramphenicol resistant donor cassetteDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceDec. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
AatII-pRPS5A-PTP-3Xflag-rbc L 294 Right_G1397 C-ABE
Plasmid#189652Purposerbc L 294 Right_G1397 C-ABEDepositorInsertTALE and DddAtox and TadA 8e
UseTALENExpressionPlantAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBY2727
Plasmid#35399DepositorInsertSnAvi-tag
UseMouse TargetingExpressionMammalianPromoterCMVAvailable SinceApril 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEIAV-TLoop-Chr2-YFP
Plasmid#80160PurposeExpression in mammalian cellsDepositorInsertChr2
UseLentiviralTagsYFPMutationH134RPromoterCMV TetOx7Available SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBY2946
Plasmid#23223DepositorInsertSnAvi
ExpressionWormAvailable SinceMay 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMXLC_pFa
Plasmid#114219PurposePOC12355, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type p-aDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-gap16-ClopHensor
Plasmid#26006DepositorInsertgap16-ClopHensor
TagsGap16 and Strep-IIExpressionMammalianMutationN-term (16AA) of Gap-43Available SinceSept. 16, 2010AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestRFP_HuB
Plasmid#65764Purposeexpresses RFP-tagged HuB in mammalian cellsDepositorAvailable SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
mP14H1
Plasmid#84369Purposeantigen for mouse PRDM14 purification ( aa 1-231)DepositorInsertPRDM14
Tags6xHisExpressionBacterialMutationonly aa 1-231 presentPromoterT7Available SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPS934
Plasmid#8855DepositorAvailable SinceAug. 3, 2005AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBS L30 Flag-Apex2-Rab18
Plasmid#166403PurposeRab18 fused to APEX2 and a Flag tag in N-ter under control of a weak L30 promoter.DepositorInsertRab18
TagsAPEX2 and FlagExpressionMammalianPromoterL30 weak promoterAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBS L30 Flag-Apex2-Rab5C
Plasmid#166404PurposeRab5C fused to APEX2 and a Flag tag in N-ter under control of a weak L30 promoter.DepositorInsertRab5C
TagsAPEX2 and FlagExpressionMammalianPromoterL30 weak promoterAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
POC1553
Plasmid#238470PurposepMOBC360_VL: Vector Left (VL) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pART15-asB539
Plasmid#127394PurposeExpresses amcyan fluorescent gene and sRNA nt 539-559DepositorInsertAmCyan
ExpressionBacterialPromoterPBADAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1554
Plasmid#238471PurposepMOBC360_VR: Vector Right (VR) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1525
Plasmid#226496PurposepMOBC360_VM: Vector Middle (VM) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB4GWnY-MpPHOT
Plasmid#228472PurposeVector for the expression of MpPHOT fused to the N-terminal half of YFP in plants (for Agrobacterium-mediated genetic transformation.)DepositorInsertMpPHOT
ExpressionBacterial and PlantAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only