We narrowed to 13,309 results for: sequence
-
Plasmid#65332Purposestandard plasmids for exogenus pathway assembly haboring recombination sequence 2 (Universal Recombination Region 2) which could be released and ligated to series of TUsDepositorInsertURR2
UseSynthetic BiologyAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMV-URR1
Plasmid#65331Purposestandard plasmids for exogenus pathway assembly haboring recombination sequence 1(Universal Recombination Region 1) which could be released and ligated to series of TUsDepositorInsertURR1
UseSynthetic BiologyAvailable SinceAug. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
Sdk1-AP-His
Plasmid#72008PurposeExpresses the extracellular region of the Sdk1 protein (endogenous signal peptide replaced with CD33 signal peptide), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
P12-bio
Plasmid#47725PurposeExpresses enzymatically monobiotinylated full-length P12 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised P12
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Sdk1-Fc-His
Plasmid#72134PurposeExpresses the extracellular region of the Sdk1 protein (endogenous signal peptide replaced with CD33 signal peptide), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
(81) pcDNA3.1-BC2-Nup62-Flag-EPEA
Plasmid#168094PurposeNucleoporin Nup62 with N-terminal BC2 nanobody tag and C-terminal Flag and EPEA nanobody tagsDepositorInsertNup62-Ubc-Flag-EPEA
TagsBC2-Tag, EPEA-tag, and Flag-tagExpressionMammalianMutationP229A, S283T on Nup62 native sequencePromoterT7/CMVAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
CLAG3.2-bio
Plasmid#47797PurposeExpresses enzymatically monobiotinylated full-length CLAG3.2 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised CLAG3.2
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
LLP251 pEF1a-UNC5C-4-SunTag
Plasmid#100940PurposeTALE vector with UNC5C-4 insert fused to SunTagx10, driven by EF1a, with 3xHA tag, no PURO geneDepositorInsertTALE target sequence for UNC5C, SunTag array (10xGCN4)
UseTALENTags3xHAExpressionMammalianAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only