We narrowed to 13,309 results for: sequence
-
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV -HA-Luciferase
Plasmid#227802Purposeexpressing HA tag and the coding sequence of luciferase by the constitutive CMV promoterDepositorInsertHA-Luciferase
UseAAVPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJR100
Plasmid#187240PurposeLentiviral sgRNA vector for Perturb-seq with mU6 sgRNA promoter, CR1 constant region with CS1 capture sequence in stem loop, and UCOE EF1alpha driving PURO-BFP marker expressionDepositorInsertLentiviral sgRNA vector for Perturb-seq with mU6 promoter
UseLentiviralAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP1-bio
Plasmid#47709PurposeExpresses enzymatically monobiotinylated full-length MSP1 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP1 (MSP1 Synthetic, Plasmodium falciparum)
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
LYSO-LRRK2
Plasmid#193582PurposeExpresses human full-length LRRK2 with a lysosomal targeting sequence from LAMTOR1 (1-39aa) and 3xFLAG on the N-terminusDepositorInsertLeucine-rich repeat kinase 2 (LRRK2 Human)
TagsLAMTOR1(1-39aa) and 3xFLAGExpressionMammalianPromoterCMVAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Tau(T217E)
Plasmid#187024PurposeExpresses EGFP tagged human 2N4R tau (with T217E mutation) in mammalian cells with CMV promoterDepositorInsertMAPT (MAPT Human)
TagsEGFPExpressionMammalianMutationChanged Threonine 217 to Glutamic acidPromoterCMVAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-nosT
Plasmid#71272PurposeEntry clone containing nosT. Necessary to complete the transcriptional reporters by providing the poly-A tail. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertnopaline synthase terminator
UseGatewayAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPapi
Plasmid#96921Purposeexpression of S aureus SaCas9 (SauCas9) and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in SpCas9-expressing cell lines for dual Cas9 "Big Papi" screens. aka pXPR207.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin-FLEX-soCoChR-GFP
Plasmid#107712PurposeA somatic channelrhodopsin, which enables single cell, single millisecond resolution optogenetics. Cre-dependent virusDepositorHas ServiceAAV9InsertsoCoChR-GFP
UseAAVTagsEGFP and KA2ExpressionMammalianPromoterhSynapsinAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only