We narrowed to 24,790 results for: SPR
-
Plasmid#244807PurposeModified plasmid from pADH99 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertCauHIS1_US
UseCRISPRTagsC. albicans MAL2 promoter, C. albicans codon opti…ExpressionYeastAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1017
Plasmid#239939PurposeCaMV 35S driving the expression of dCas9-ZAT10(1x)DepositorInsertCaMV 35S::dCas9-ZAT10(1x)
UseCRISPR and Synthetic BiologyMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1016
Plasmid#239938PurposeCaMV 35S driving the expression of dCas9-ZAT10(2x)DepositorInsertCaMV 35S::dCas9-ZAT10(2x)
UseCRISPR and Synthetic BiologyMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1023
Plasmid#239945PurposeCaMV 35S driving the expression of dCas9DepositorInsertCaMV 35S::dCas9
UseCRISPR and Synthetic BiologyMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1015
Plasmid#239937PurposeCaMV 35S driving the expression of dCas9DepositorInsertCaMV 35S::dCas9
UseCRISPR and Synthetic BiologyMutationN/AAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1019
Plasmid#239941PurposeCaMV 35S driving the expression of dCas9-ZAT10(1x)DepositorInsertCaMV 35S::dCas9-ZAT10(1x)
UseCRISPR and Synthetic BiologyExpressionPlantMutationN/AAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1018
Plasmid#239940PurposeCaMV 35S driving the expression of dCas9DepositorInsertCaMV 35S::dCas9
UseCRISPR and Synthetic BiologyExpressionPlantMutationN/AAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat-ADE2
Plasmid#232106PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg-ADE2
Plasmid#232104PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg-ADE2
Plasmid#232107PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB9
Plasmid#210036PurposeContains Cas9 gRNA cloning site, inducible Cas9, UCOE, puro-T2A-eGFPDepositorInsertsCas9
puro-T2A-eGFP
UseCRISPRTagsSV40 NLS and nucleoplasmin NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Apr
Plasmid#208000PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_dCas9-XTEN-KRAB-p2A-GFP
Plasmid#222108PurposeDonor vector for CRISPRi integration at AAVS1 with a GFP fluorophoreDepositorInsertCRISPRi-kox1(KRAB) (cas9 S. pyogenes, Human)
UseAAV and CRISPRTagsHA and P2A-GFPExpressionMammalianMutationD10A, H840AAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDM030
Plasmid#216810PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and ble selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA035
Plasmid#216015PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-SpRY_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_131
Plasmid#216095PurposeCas12a [EnAs] CRISPRa targeting CD97, CD4, CD26, CD274, positive controlDepositorInsertCD97, CD4, CD26, CD274 guides
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-recipient_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211688PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and guide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CHyMErA_U6(SpCas9_I-SceI)-(AsCas12_PacI)_PGK-puro
Plasmid#189634PurposeLentiviral expression of single SpCas9 and AsCas12a gRNAs for generating combinatorial CHyMErA 3Cs librariesDepositorInserthU6 Cas9-Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
A3Bctd-L7G-Cas9n-UGI-NLS
Plasmid#198886PurposeExpress A3Bctd-L7G BE3-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
TagsNLSExpressionMammalianMutationLoop 7 of A3GPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
A3Bctd-D314E-Cas9n-UGI-NLS
Plasmid#198887PurposeExpress A3Bctd-D314E BE3-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
TagsNLSExpressionMammalianMutationD314EPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
eA3Ai-Cas9n-UGI-NLS
Plasmid#207165PurposeExpress A3A with an N57G point mutation and an intron in a BE3-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3A (APOBEC3A Human)
TagsCas9-UGI--NLSExpressionMammalianMutationN57GPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
eA3Ai-max
Plasmid#207166PurposeExpress A3A with an N57G point mutation and an intron in a BE4max-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3A (APOBEC3A Human)
TagsCas9-UGI-UGI-NLS and NLSExpressionMammalianMutationN57GPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Bla-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196081PurposeInducible CRISPRi vector conferring blasticidin S resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196083PurposeInducible CRISPRi vector conferring hygromycin B resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Bla-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196075PurposeConstitutive CRISPRi vector conferring blasticidin S resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Hyg-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196077PurposeConstitutive CRISPRi vector conferring hygromycin B resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUBI-RZ-Cas12j2
Plasmid#189781PurposeCas12j2 (CasΦ) Gateway gRNA entry plasmid using Zea mays Ubi promoter and HH, HDV ribozyme processingDepositorInsertgRNA cloning site
UseCRISPRAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK91 pHomL-TDH3p-Neon(gfp)-Link-SCS2tmh-SSA1t-HomR (AmpR)
Plasmid#179075PurposeVector containing a yeast integration cassette for expressing TDH3p-Neon(gfp)-Link-SCS2tmh, an overexpressed (bright) marker for the endoplasmic reticulumDepositorInsertTDH3p-Neon(gfp)-Link-SCS2tmh
ExpressionYeastAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK66 pHomL-RPL18Bp-TOM70-Link-Neon(gfp)-SSA1t-HomR (AmpR)
Plasmid#179050PurposeVector containing a yeast integration cassette for RPL18B-driven expression of TOM70-Link-Neon(gfp), a marker for the mitochondriaDepositorInsertRPL18Bp-TOM70-Link-Neon(gfp)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK65 pHomL-RPL18Bp-preCOX4-Link-Neon(gfp)-SSA1t-HomR (AmpR)
Plasmid#179049PurposeVector containing a yeast integration cassette for RPL18B-driven expression of preCOX4-Link-Neon(gfp), a marker for the mitochondriaDepositorInsertRPL18Bp-preCOX4-Link-Neon(gfp)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK64 pHomL-RPL18Bp-PEX25-Link-Neon(gfp)-SSA1t-HomR (AmpR)
Plasmid#179048PurposeVector containing a yeast integration cassette for RPL18B-driven expression of PEX25-Link-Neon(gfp), a marker for the peroxisomeDepositorInsertRPL18Bp-PEX25-Link-Neon(gfp)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK63 pHomL-RPL18Bp-PDR16-Link-Neon(gfp)-SSA1t-HomR (AmpR)
Plasmid#179047PurposeVector containing a yeast integration cassette for RPL18B-driven expression of PDR16-Link-Neon(gfp), a marker for the lipid dropletDepositorInsertRPL18Bp-PDR16-Link-Neon(gfp)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only