We narrowed to 4,490 results for: GCA
-
Plasmid#76092Purpose3rd generation lentiviral gRNA plasmid targeting human BRD3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
BRD3 gRNA (BRDN0001147217)
Plasmid#76094Purpose3rd generation lentiviral gRNA plasmid targeting human BRD3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DYRK3 gRNA (BRDN0001145918)
Plasmid#75547Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA5 gRNA (BRDN0001146427)
Plasmid#77373Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA5DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKAA2 gRNA (BRDN0001146900)
Plasmid#76635Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAA2DepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWT057c
Plasmid#96870PurposeHHR-bsgRNA-FANCFDepositorInsertHHR-bsgRNA-FANCF
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT057d
Plasmid#96871PurposedHHR-bsgRNA-FANCFDepositorInsertdHHR-bsgRNA-FANCF
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT016h
Plasmid#96854PurposeHHR-bsgRNA-GFP (17 nt blocker)DepositorInsertHHR-bsgRNA-GFP (17 nt blocker)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT016d
Plasmid#96855PurposedHHR-bsgRNA-GFP (17 nt blocker)DepositorInsertdHHR-bsgRNA-GFP (17 nt blocker)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT049d
Plasmid#96862Purposeguanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsertguanine-agRNA (19 nt blocker with bulges, RFP activation)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT049e
Plasmid#96863Purpose(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsert(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
csr-1_qa-2_dsimpα_bar
Plasmid#251402PurposeEnables inducible expression of double-stranded RNA targeting importin α (NCU01249) under the control of the qa-2 promoter, with the expression cassette inserted at the csr-1 locus.DepositorInsertimportin alpha
UseRNAiAvailable SinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
OgeuIscB AGC RNA
Plasmid#222866PurposeThis plasmid codes for the guide of the OgeuIscB with a AGC targetDepositorInsertOgeuIscB omega RNA with a (AGC)6 target sequence
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO.1 mTagBFP2 rat PGK1 shRNA
Plasmid#222869PurposeExpresses mTagBFP2 along with an shRNA against rat PGK1DepositorAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
MPP1 gRNA (BRDN0001148092)
Plasmid#77805Purpose3rd generation lentiviral gRNA plasmid targeting human MPP1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MARK3 gRNA (BRDN0001146658)
Plasmid#77719Purpose3rd generation lentiviral gRNA plasmid targeting human MARK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MARK2 gRNA (BRDN0001146902)
Plasmid#77592Purpose3rd generation lentiviral gRNA plasmid targeting human MARK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATR gRNA (BRDN0001147587)
Plasmid#77551Purpose3rd generation lentiviral gRNA plasmid targeting human ATRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only