We narrowed to 13,309 results for: sequence

#72147

Expresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains no deletion in exon 3), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 29, 2016

Academic Institutions and Nonprofits only

#71948

Expresses the extracellular region of the FLRT2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Jan. 22, 2016

Academic Institutions and Nonprofits only

#183636

PET28-FnCas12a-EP16 can efficiently recognize a broad range of PAM sequences including YN (Y = C or T), TAC and CAA.

Yunzi Luo

Wang et al Biotechnol Bioeng. 2019 Jun;116(6):1463-

Oct. 26, 2022

Academic Institutions and Nonprofits only

#47728

Expresses enzymatically monobiotinylated full-length Pf92 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.

Gavin Wright

Crosnier et al Mol Cell Proteomics. 2013 Sep 16.

Feb. 4, 2014

Academic Institutions and Nonprofits only

#87394

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#67864

bacterial expression of PRORP (KIAA0391), full coding sequence (mitoch. form) + C-term. myc-His tag

Walter Rossmanith

Holzmann et al Cell. 2008 Oct 31;135(3):462-74. doi: 10

Aug. 14, 2015

Academic Institutions and Nonprofits only

#98966

myc-tagged human CCR5 fused to C-terminus of split Venus

Erik Procko

Heredia et al J Immunol. 2018 Apr 20. pii: jimmunol.18

April 24, 2018

Academic Institutions and Nonprofits only

#139331

Plasmid expressing a sgRNA to introduce BRCA1 Q1779Stop using base editing

Alberto Ciccia

Billon et al Cell Rep. 2020 Mar 10;30(10):3280-3295.e

May 22, 2020

Academic Institutions and Nonprofits only

#113689

SaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS

Jonathan Ploski

Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413.

Dec. 20, 2018

Academic Institutions and Nonprofits only

#147997

Mammalian Expression of HsNot1iso1_840-1605

Elisa Izaurralde

Chen et al Mol Cell. 2014 Jun 5;54(5):737-50. doi:

Nov. 1, 2022

Academic Institutions and Nonprofits only