We narrowed to 2,101 results for: CO
-
Plasmid#89929PurposeExpresses Insulin-GLuc from the CMV promoter. Gaussia Luc is inserted within the C-peptide and is co-secreted with insulin.DepositorInserthuman insulin-Gaussia-Luciferase (INS Synthetic, Human)
UseTagsExpressionMammalianMutationDNA sequence for Gaussia luciferase was humanized…PromoterCMVAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorInsertAICD (APP Human)
UseAAVTagsExpressionMutationNonePromoterhuman synapsinAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2AmCherry-W
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorInsertYAP1 (YAP1 Human)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromoterU6Available sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(milli)-BoNT/B(147-441, Y365A)
Plasmid#122985PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(milli)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(milli)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains A58V,R73Q "milli" mutatio…Promoterhuman synapsinAvailable sinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-3xHA-hM3D(Gq)-P2A-ArgiNLS-oScarlet
Plasmid#220608PurposeNeuron-specific, Cre-dependent co-expression of 3x HA-tagged excitatory hM3D(Gq) DREADD receptor, and a single-cell discriminating version of oScarlet as a reporter.DepositorInsert3x HA-hM3D(Gq)-P2A-AgiNLS-oScarlet
UseAAV and Cre/LoxTags3x HA; ArgiNLSExpressionMammalianMutationPromoterhSynAvailable sinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-FLAG-KORD-P2A-ArgiNLS-AausFP1
Plasmid#220610PurposeNeuron-specific, Cre-dependent co-expression of FLAG-tagged inhibitory KORD DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporterDepositorInsertFLAG-KORD-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianMutationPromoterhSynAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CaMKII-TurboID
Plasmid#227178PurposeCo-expression of FLAG-tagged TurboID and T2A-mCherry under the CaMKIIα short promoter by AAV vectorDepositorInsertTurboID
UseAAVTagsFLAG and T2A-mCherryExpressionMammalianMutationPromoterCaMKIIa_shortAvailable sinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2AmCherry-W
Plasmid#163176PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorInsertWWTR1 (WWTR1 Human)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromoterU6Available sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
FGFR1_HUMAN_D0
Plasmid#79719PurposeThis plasmid encodes the kinase domain of FGFR1. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertFGFR1 (FGFR1 Human)
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Prom1-TEVp-TwinStrep-His / IRES2 / Pcdh21-TEVp-Myc-Flag
Plasmid#210820PurposeMammalian overexpression vector for polycistronic co-expression of C-terminally Strep and His tagged human Prom1s1 (WT) and C-terminally Myc and Flag tagged human Pchd21 (WT)DepositorUseTagsMyc, 3xFlag and TwinStrep, 10xHisExpressionMammalianMutationPromoterCMV and CMV / IRES2Available sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(micro)-BoNT/B(147-441, Y365A)
Plasmid#122986PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(micro)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(micro)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains R73Q "micro" mutation, Bo…Promoterhuman synapsinAvailable sinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-BoNT/B(1-146)-iLID
Plasmid#122982PurposeAAV plasmid with human synapsin promoter driving mCh and BoNT/B amino acids 1-146 fused to iLID(V416I), separated with an IRES element. Co-express with SSPB-BoNT(147-441, Y365A) for sPA-BoNTDepositorInsertmCh-IRES-BoNT/B(1-146)-iLID
UseAAVTagsmChExpressionMammalianMutationiLID contains long lived V416I mutationPromoterhuman synapsinAvailable sinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2AmCherry-W
Plasmid#163177PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorInsertWWTR1 (WWTR1 Human)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromoterU6Available sinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-beta-5 in pcDNAI/Amp
Plasmid#55708PurposeAn amino-terminal fragment of mCerulean was fused to Gbeta5. When co-expressed with a carboxyl terminal CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertmCer(1-158)-beta5 (GNB5 Human, Aequorea victoria)
UseTagsCer(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-5 was amplified via PCR, which added an N-t…PromoterCMVAvailable sinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2ABFP-W
Plasmid#163178PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tagDepositorInsertYAP1 (YAP1 Human)
UseCRISPR and LentiviralTagsBFPExpressionMammalianMutationPromoterU6Available sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
MK01_HUMAN_D0
Plasmid#79713PurposeThis plasmid encodes the kinase domain of MK01. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertMK01 (MAPK1 Human)
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC2_1k)-PGKpuro2ABFP-W
Plasmid#208416PurposeLentiviral gRNA plasmid targeting human BIRC2 gene, co-expression of BFP tagDepositorInsertBIRC2 (BIRC2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationN/APromoterhuman U6Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC2_2b)-PGKpuro2ABFP-W
Plasmid#208417PurposeLentiviral gRNA plasmid targeting human BIRC2 gene, co-expression of BFP tagDepositorInsertBIRC2 (BIRC2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationN/APromoterhuman U6Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only