We narrowed to 2,923 results for: COB;
-
Plasmid#149311PurposeGateway-compatible Entry vector, with insert of NSP8 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1. Does not contain stop codon.DepositorInsertNSP8 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorTagsExpressionMutationMany synonymous changes due to codon optimizationPromoterAvailable SinceMay 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
CL20_mEGFP_CD44_PDHX
Plasmid#205790PurposeExpress mEGFP-tagged fusion protein, CD44_PDHX from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_RCSD1_ABL2
Plasmid#205911PurposeExpress mEGFP-tagged fusion protein, RCSD1_ABL2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_SMARCA2_ZNF384
Plasmid#205922PurposeExpress mEGFP-tagged fusion protein, SMARCA2_ZNF384 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_9
Plasmid#60258PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_25
Plasmid#60305PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertROCK1 enhancer (ROCK1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 S 24nt-del
Plasmid#153952PurposeGateway-compatible Entry vector, with insert of S CDS bearing a 24nt deletion from SARS-CoV-2 genomic analysis in Davidson et al. 2020DepositorInsertS (S SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorTagsExpressionMutationMany synonymous changes due to codon optimizationPromoterAvailable SinceJune 23, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 S 24nt-del_nostop
Plasmid#153953PurposeGateway-compatible Entry vector, with insert of S CDS bearing a 24nt deletion from SARS-CoV-2 genomic analysis in Davidson et al. 2020DepositorInsertS (S SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorTagsExpressionMutationMany synonymous changes due to codon optimizationPromoterAvailable SinceJune 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGL4.23 C3_9
Plasmid#60295PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertNKX6-1 enhancer (NKX6-1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_29
Plasmid#60309PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertZFP36L2 enhancer (ZFP36L2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 ORF7B C-trunc_nostop
Plasmid#153956PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorTagsExpressionMutationMany synonymous changes due to codon optimizationPromoterAvailable SinceJune 11, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 ORF7B C-trunc
Plasmid#153957PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorTagsExpressionMutationMany synonymous changes due to codon optimizationPromoterAvailable SinceJune 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR D-TOPO-C3_10
Plasmid#60259PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_25
Plasmid#60268PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_31
Plasmid#60310PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertSLC2A2 enhancer (SLC2A2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_21
Plasmid#60296PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertCDKN2BAS enhancer (CDKN2B-AS1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_19
Plasmid#60302PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertTHADA enhancer (THADA Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_MSCV-ires-GFP
Plasmid#237496PurposeRetroviral empty vectorDepositorTypeEmpty backboneUseRetroviralTagsExpressionMammalianMutationPromoterAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V1
Plasmid#222498PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V1 (R887E) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V1 (R887E) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E in Dnmt3APromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only