We narrowed to 14,223 results for: Cas9
-
Plasmid#172215PurposeExpresses Campylobacter jejuni Cas9 (CjeCas9) in bacterial cellsDepositorInsertCas9 endonuclease from the Campylobacter jejuni Type II CRISPR/Cas system
TagsHistagPromoterT7Available sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU6b
Plasmid#66196Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU6bAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PE2_lenti
Plasmid#237895PurposePrime Editor in lentiviral backboneDepositorInsertPE2
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable sinceSept. 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60228PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA control targeting LacZ. AAV backbone.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available sinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV hU6-gRNA(anti-sense) hUbC-VP64-dCas9-VP64-T2A-GFP
Plasmid#66707Purposeexpresses a single gRNA and VP64-dCas9-VP64DepositorInsertshU6-gRNA expression cassette
S.Pyogenes VP64-dCas9-VP64
UseLentiviral and Synthetic BiologyTagsVP64MutationD10A and H840APromoterhU6 and hUbCAvailable sinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-dCas9-VPR-H2B-GFP (CRISPRa)
Plasmid#175571PurposeInactivated Cas9 (dCas9) fusion to VPR for the purpose of targeted activationDepositorTypeEmpty backboneUseCRISPRAvailable sinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
GAG-CRErec
Plasmid#119971PurposeExpresses GAG (FMLV) fused with CRE recombinase for the production of VLPs loaded with CRE proteinDepositorInsertGAG-nlsCRErec
TagsnlsExpressionMammalianPromoterhCMVAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M_ST1n_VPR
Plasmid#63799PurposeST1-dCas9 with VP64-p65-Rta (VPR) fused to it's C-terminus; mammalian vectorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertST1-dCas9-VPR
UseCRISPR and Synthetic BiologyTagsVPR (VP64-p65-Rta)ExpressionMammalianPromoterCMVAvailable sinceApril 14, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3-Flag::UbvG08 I44A, deltaGG
Plasmid#74939PurposeUbiquitin variant that binds to and occludes the ligand binding site of the 53BP1 Tudor domain (i53). Blocks 53BP1 from accumulating at sites of DNA damage. Potent selective inhibitor of 53BP1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUbiquitin
TagsFlagExpressionMammalianMutationUbvG08 with I44A mutation and no terminal GlycinesPromoterCMVAvailable sinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pX330_SpCas9_USP7 Exon 3 gRNA
Plasmid#131257PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanised S. pyogenes Cas9 nuclease
ExpressionMammalianAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pXCas9H840A
Plasmid#60900PurposeDual Expression Vector for Cas9 H840A nickase and gRNADepositorTypeEmpty backboneUseCRISPRTags3XFLAGExpressionMammalianPromoterCBh and U6Available sinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-BFP empty
Plasmid#80976PurposeCas9, TagBFP, and sgRNA expressionDepositorTypeEmpty backboneExpressionMammalianAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only