11,508 results
-
Plasmid#83027Purposeexpresses an shRNA against NKCC1DepositorInsertshNKCC1
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6Available SinceOct. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
BII-Sh-FUCCI
Plasmid#133363PurposePiggybac vector for shRNA-mediated knockdown, co-expressed with FUCCI cell cycle reporterDepositorInsertClover-Geminin-IRES-mKO2-Cdt1
TagsHA-tagged Clover-GemininExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TOMM20
Plasmid#207789PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of TOMM20 for knock-in.DepositorInsertsgRNA Targeting C-terminus of TOMM20 (TOMM20 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgRNA
Plasmid#124844PurposeVector for Cre-dependent expression of SaCas9DepositorInsertSaCas9, gRNA scaffold
UseAAV, CRISPR, and Mouse TargetingTagsNLS and NLS-3xHAAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-U6sgRNA(BbsI)-PGKpuro2ABFP
Plasmid#102796PurposeRetrovirus for delivery of one sgRNA (empty, bbsI)DepositorInsertU6 sgRNA
UseCRISPR and RetroviralExpressionMammalianPromoterU6Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXAT2
Plasmid#80494PurposeAAVS1 sgRNA expression vectorDepositorInsertAAVS1 sgRNA-T2
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Guide-Puro
Plasmid#86708PurposeMakes CRISPR gRNAs detectable by single-cell RNA-seq. The gRNA is expressed as part of the puromycin resistance mRNA transcribed by RNA Pol II and in its functional form from the hU6 promoter.DepositorInsertEF1a-Puro-WPRE-hU6-gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEf1a-goldDn29-dCas9-P2A-GFP
Plasmid#247157PurposeMammalian expression of a human codon optimized engineered goldDn29 recombinase fused to dCas9 and gRNA expression cassette for targeting attH1 with H1-g3DepositorInsertgoldDn29-dCas9-P2A-GFP
TagsSV40 NLSExpressionMammalianMutationM6I/E70G/A224P/G227V/Q332K/N341K/L393P/D503NPromoterEf1aAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-AAVS1-5-1kbdonor
Plasmid#234735PurposePseCAST crRNA targeting AAVS1-5, with 1 kb donor transposonDepositorInsertAAVS1-5 crRNA
ExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-sgAAVS1-1
Plasmid#129726PurposeExpressing SpCas9 and sgAAVS1-1DepositorInsertSpCas9 and sgAAVS1-1
UseCRISPRTagsP2A-PuroExpressionMammalianPromoterhU6Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-SpCas9-miniU6-sgRNAShank3
Plasmid#213973PurposeAAV vector to express SpCas9 driven by pCALM1 promoter for targeting Shank3 locusDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
hNTo1-qgRNA-pYJA5
Plasmid#217781PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLG1 library vector (pU6-sgRNA Ef1alpha-Puro-T2A-mcherry)
Plasmid#217306PurposesgRNA mcherry + PuromycinDepositorInsertpU6-sgRNA, Ef1alpha-Puro-T2A-mcherry
UseCRISPRPromoterU6, Ef1alphaAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_ect2_cmlc2-nmKate
Plasmid#238410PurposeDrives expression of 3 different gRNAs targeting ect2, and expression of nuclear mKate in cardiomyocytesDepositorInsertnuclear mKate/3 gRNAs targeting ect2
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_cmlc2(myl7)_cmlc2-nmKate
Plasmid#238374PurposeDrives expression of 3 different gRNAs targeting cmlc2 (myl7), and expression of nuclear mKate in cardiomyocytes.DepositorInsertnuclear mKate/3 gRNAs targeting cmlc2
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgControl
Plasmid#125836PurposeKO controlDepositorInsertControl
UseLentiviralAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLdCN
Plasmid#84290PurposeExpress gRNA and Cas9 in Leishmania with Neomycin resistanceDepositorInsertgRNA and Cas9
UseCRISPR; LeishmaniaPromoterL. donovani ribosome RNA promoterAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
Pepper-fused sgRNA
Plasmid#217520PurposeExpresses Pepper-fused sgRNA in mammalian cells with U6 promoterDepositorInsertPepper-fused sgRNA for spCas9
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-Cj-sgRNA
Plasmid#89753PurposeU6 promoter driven expression of Cj-SgRNA cloned with BsmbIDepositorInsertCj-SgRNA
UseSgrna expression under u6 promoterPromoterU6Available SinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only