We narrowed to 109 results for: Atr
-
TypeBlog Post...Nicola Patron is Head of Synthetic Biology at the Sainsbury Laboratory, where she often feels more like...that go on between plants and their pathogens. As Patron explains it, her work has always been focused on...Modular Cloning (MoClo) Kit. What does it include? Patron: Sainsbury has a mandate to share and educate and...Addgene: Will the MoClo tools work in any plant? Patron: The MoClo kit is entirely for dicots, not grasses...tips for those looking to get started with MoClo? Patron: The parts will be familiar to most plant scientists...there other tools you are working on for plants? Patron: Our lab and others at the Sainsbury are working... of engaging about science in that way for you? Patron: I started my Twitter account recently inspired...
-
p53 Pathway
TypeCollection...activating factor 1 ATM ATM serine/threonine kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed...ribonucleotide reductase M2 B (RRM2B) PAG608 Zinc finger, matrin-type 3 PAI Serpin peptidase inhibitor, clade E ... -
Protocol - How to Run an Agarose Gel
TypeProtocol...the negatively charged DNA through an agarose gel matrix toward a positive electrode. Shorter DNA fragments... -
Supporting Rare Disease Research with BeHeard 2017
TypeBlog Post...prevalence of spinal muscular atrophy (SMA)." European Journal of Paediatric Neurology 19 (2015): S64-S65...afflictions. Elia Di Schiavi - Spinal muscular atrophy Dr. Elia Di Schiavi is a Research Scientist at ...Naples, Italy. His group works on spinal muscular atrophy, a disease in which disruption of the smn1 gene...the smn1 gene is known to cause spinal muscular atrophy, the molecular mechanisms behind the disease are...restore motor neuron function in spinal muscular atrophy patients. Noushin Nabavi - Peritoneal Mesothelioma... -
Antibodies 101: The Basics of Western Blotting
TypeBlog Post...anode/iblot gel matrix, the blotting membrane, the gel, a copper cathode/iblot gel matrix, and filter paper...remain intact and the protein is separated through a matrix by charge. In a denaturing western, the protein...smaller molecules moving more quickly through the matrix. For the purpose of this blog, we will be focusing...proteins encounter less resistance in the acrylamide matrix and migrate faster through the gel. For better ... -
Neurodegeneration Plasmid Collection
TypeCollection...Arrowsmith 32880 FLAG-MATR3 MATR3 Flag CMV ALS Yossi Shiloh 32881 FLAG-Matr3 delRRM1 MATR3 Flag CMV ALS Yossi...Shiloh 32882 FLAG-Matr3 delRRM2 MATR3 Flag CMV ALS Yossi Shiloh 32883 FLAG-Matr3 delZnF1 MATR3 Flag CMV ALS...174271 pAPM-miR30-MATR3-ts1 MATR3 SFFV ALS Jeremy Luban 174272 pAPM-miR30-MATR3-ts2 MATR3 SFFV ALS Jeremy...H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1mismatch SOD1 H1 ALS Patrick Aebischer...ALS Yossi Shiloh 32884 FLAG-Matr3 delZnF2 MATR3 Flag CMV ALS Yossi Shiloh 34927 pTRE_tau-LacZ::tTA-H100Y...CMV Parkinson's Patrick Aebischer 36070 pAAV asyn S87A/S129A SNCA CMV Parkinson's Patrick Aebischer 36071...EGFP OPTN GFP CMV ALS Beatrice Yue 68839 pOPTN1-209-EGFP OPTN GFP CMV ALS Beatrice Yue 68840 pOPTN1-424... -
New Norepinephrine Indicators: nLightG and nLightR
TypeBlog Post... and were only available as green probes. The Patriarchi Lab aimed to overcome these limitations by developing...researchers looking to study norepinephrine, the Patriarchi lab continues to work on further improvements...nLightG. Many thanks to Mike Waring and Tommaso Patriarchi for their assistance with this blog post. References...Benke, D., Weber, B., Bohacek, J., Reiner, A., … Patriarchi, T. (2023). Sensitive multicolor indicators for... -
Common Injection Routes in Mice
TypeBlog Post... do not require any punctures. Intratracheal instillation Intratracheal instillation is used to deliver...Intranasal instillation is very similar to its intratracheal counterpart, as both procedures target the lungs...Anesthesia Spinal cord 30 up to 0.01 mL Expert Intratracheal Anesthesia Trachea 20–23 (tubing) < 0.07 mL ... -
Important Considerations When Using AAVs
TypeBlog Post...communities. Many thanks to our guest blogger Katrina Armstrong. Katrina Armstrong is a Neurophysiology Msc Student...This post was contributed by guest blogger Katrina Armstrong, a Neurophysiology Msc Student at the University...serotonin in movement. Follow her on twitter @katrinaboards. References 1. Russell, David W. "AAV vectors... -
Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins
TypeBlog Post...Kamenyeva et al. 2015)? How do blood monocytes patrol blood vessels during immune responses (Auffray ...and tissues by a population of monocytes with patrolling behavior." Science 317.5838 (2007): 666-670. ...17673663. 14. Finsterbusch, Michaela, et al. "Patrolling monocytes promote intravascular neutrophil activation... PubMed PMCID: PMC5024581. 15. Celli, Susanna, Béatrice Breart, and Philippe Bousso. "Intravital two-photon... -
Addgene’s Top 10 Blog Posts from 2014
TypeBlog Post...Resistance Genes By Marcy Patrick Plasmids 101: Yeast Vectors By Marcy Patrick CRISPR-Cas9 FAQs Answered...Morgan Plasmids 101: Mammalian Vectors By Marcy Patrick Will You Be My Mentor? Finding and Asking for... -
Don’t FRET: Bimolecular Fluorescence Complementation Makes Visualizing Protein-Protein Interactions Easy
TypeBlog Post...guest blogger Patrick Miller-Rhodes from the University of Rochester Medical Center! Patrick is equal parts...This post was contributed by Patrick Miller-Rhodes from the University of Rochester Medical Center. ... -
New Tools Enable CRISPRa for Neuroscience Applications
TypeBlog Post...guest blogger Patrick Miller-Rhodes from the University of Rochester Medical Center. Patrick Miller-Rhodes...This post was contributed by Patrick Miller-Rhodes, a Ruth L. Kirschstein NRSA Predoctoral Fellow at ... -
What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program
TypeBlog Post...) - perhaps you’ll choose to study Crepidula atrasolea or Prochlorococcus with your next project. Gymnotiformes... aspects of cognition. Spiralians - Crepidula atrasolea (Jonathan Henry) This black footed slipper snail...bottleneck. New gif for #MolluscMonday: #Crepidula atrasolea juvenile, light microscope with polarizing filter... -
Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View
TypeBlog Post...times. Many thanks to our guest blogger, Katrin Michel! Katrin Michel is a Postdoctoral Researcher at MIT...This post was contributed by guest blogger Katrin Michel. Cre-lox is an incredibly popular and powerful... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post... that they can be imported to the mitochondrial matrix. Gottlieb’s lab has used an inducible MitoTimer...Addgene depositors Sylvestre Marillonnet and Nicola Patron have assembled two collections of standardized ...general eukaryotic multigene constructs, while the Patron Lab MoClo Plant Parts kit contains modules specific.../sb4001504. For further reading about Nicola Patron's MoClo kit and her plant synbio research, read ... -
New Viral Vectors - Summer 2024
TypeBlog Post...AAV9 Biosensors Patriarchi New viral service pAAV_hSyn1_nLightR AAV9 Biosensors Patriarchi New viral service... -
Validated gRNA Sequences
TypeCollection...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus... -
Six Spooky Science Stories and Halloween at Addgene
TypeBlog Post...their jaws into a leaf, and dies as its muscles atrophy. After the ant’s death, the fungal fruiting bodies...blood out. Once the blood is depleted, the tongue atrophies and falls off. The louse remains becoming the ... -
Sensing Neuronal Dopamine
TypeBlog Post... tool to detect and image DA in live animals (Patriarchi et al., 2018). Similar to calcium and glutamate...PMID: 4403305. PubMed Central PMCID: PMC426888. Patriarchi, Tommaso, et al. "Ultrafast neuronal imaging ... -
Immunology Research Plasmids and Resources
TypeCollection...FMRFAL NPPA natriuretic peptide precursor A ANF, ANP, ATFB6, CDD-ANF, PND NPPB natriuretic peptide precursor...precursor B BNP NPPC natriuretic peptide precursor C CNP NPR1 natriuretic peptide receptor A/guanylate ...cyclase A (atrionatriuretic peptide receptor A) ANPRA, ANPa, GUC2A, GUCY2A, NPRA NPR3 natriuretic peptide...type 2 AT2, ATGR2, MRX88 AMBN ameloblastin (enamel matrix protein) - AMELX amelogenin (amelogenesis imperfecta...peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) ANPRC, GUCY2B, NPRC NPY neuropeptide... -
In Vivo Biotinylation of Bacterial Fusion Proteins
TypeBlog Post... have been immobilized on a reduced glutathione matrix. The advantage of a fusion protein is the efficient...available. Factor Xa loves calcium, but metal-chelate matrices, not so much. Maybe a calcium-independent proteinase... -
What Do I Do Now? Academic v. Non-Academic Career Decisions
TypeBlog Post... notice or choice Always working on a team/in a matrix - can be frustrating for solo flyers Other people... years—a short and exciting ride Complicated matrix structures are common Small integrated teams, ... -
Comparing Cas9 to NgAgo: Can the Argonautes Best CRISPR?
TypeBlog Post...gene-editing protein - a DNA-cleaving Argonaute from Natronobacterium gregoryi, or NgAgo for short. Addgene has ... Han. “DNA-guided genome editing using the Natronobacterium gregoryi Argonaute.” Nat Biotechnol. Epub ... -
Addgene-Seeding Labs plasmid grant round 3: microbial drug resistance and biofilms, antidiabetic plant components, visualizing brain injury - and a glowing robot fish
TypeBlog Post...tuberculosis Dr. Patricia Sheen, Universidad Peruana Cayetano Heredia, Peru Patricia Sheen, Professor ... -
Rett Syndrome
TypeCollection...in Australia: a review of the epidemiology. J Pediatric . 148(3):347-352. (Link opens in a new window)...Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67. PMID: 30536762 Shahbazian...diagnosticians and risk factors for late diagnosis. Pediatr Neurol . 52, 585-591.e2. PMID: 25801175 Tillotson... -
Deisseroth INTRSECT Collection
TypeCollection...S, Sienna AC, Tepler S, Poulin JF, Ansorge M, Awatramani R, Kang UJ, Rayport S. 2018. Dopamine neuron ...Ramakrishnan C, Chan CS, Dombeck DA, Deisseroth K, Awatramani R. 2018. Mapping projections of molecularly defined...hypothalamus-habenula circuit controls aversion. Mol. Psychiatry 24(9):1351-1368. PubMed (Link opens in a new ... -
Google Forums Round Up: First Impressions of NgAgo
TypeBlog Post...et al. "DNA-guided genome editing using the Natronobacterium gregoryi Argonaute." Nature biotechnology ...enzyme." DNA-scissors (blog). Blog website. 4. Hsu, Patrick D., Eric S. Lander, and Feng Zhang. "Development... -
Plasmids 101: Optimizing Plasmid Yields
TypeBlog Post...volume of lysate passed over the binding matrix could clog the matrix when performing filter based plasmid... -
CRISPR 101: Mammalian Expression Systems and Delivery Methods
TypeBlog Post...Last updated Sep 30, 2020 by Marcy Patrick. CRISPR technology has been widely adopted for genome editing...for creating the Expression Systems table. Marcy Patrick contributed to the writing of this post. Additional... -
Tips for Using BLAST to Verify Plasmids
TypeBlog Post...default scoring matrix BLOSUM62, but you may want to check the description of the other matrices to see if ... -
Deciphering the Mysteries of Behavior with Viral Vectors
TypeBlog Post...levels in general, or anxiety associated with psychiatric diseases such as schizophrenia or bipolar disorder...the BDNF hypothesis of depression?." Molecular psychiatry 12.12 (2007): 1079. PubMed PMID: 17700574. Hare... -
Proximity Labeling: A Powerful Tool for Protein Complex Purification and Proteomic Mapping
TypeBlog Post... be captured on streptavidin affinity beads or matrices. The bait protein can even target BirA* to specific...identify the proteomic map of the human mitochondrial matrix (Rhee et al., 2013) and determine the topology ... -
Multiple Plasmids at a Low Price: Kits from Addgene
TypeBlog Post...study a matrix metalloproteinase: López-Pelegrín, Mar, et al. "A novel mechanism of latency in matrix metalloproteinases... -
Fluorescent Protein Guide: Biosensors
TypeCollection...green- and orange-emitting proteins Ratiometric Matryoshka biosensors from a nested cassette of green- and...Recording of Zn(2+) Dynamics in the Mitochondrial Matrix and Intermembrane Space with the GZnP2 Sensor. ...Nat Methods. 2023 Sep;20(9):1426-1436. Tommaso Patriarchi Norepinephrine GRAB_NE family of GPCR activation-based... Nat Methods. 2022 Feb;19(2):231-241. Tommaso Patriarchi Serotonin Red and green serotonin sensors GRAB... -
A Guide to Getting Started in Undergrad Research
TypeBlog Post...blogger Eleanor Wang, a Research Specialist in Patrick Hsu's lab at UC Berkeley. Most of the scientists...Eleanor Wang is currently a Research Specialist in Patrick Hsu’s lab at UC Berkeley. She will be starting ... -
Selecting Your Plasmid Purification Kit
TypeBlog Post... is a silica matrix fixed in a column and you flow lysate and buffers through the matrix, usually by centrifugation... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TCTTCTTGTGCTCTTATTggcaggtacctggtgacTCACCTTATGGGCGCTGA matrixmetallopeptidase15 (membrane-inserted) TAL3484 & TAL3485 ...TGATCTGTTCCTGGTAGCcgttcatgagctgggcCATGCCCTTGGACTGGAA matrixmetalloproteinase14a (membrane-inserted) TAL3486 & TAL3487... -
Biosensor AAV Preps
TypeCollection...Constitutive 9 Patriarchi 187180 pAAV_hSyn1_nLightR Syn nLightR none Constitutive 9 Patriarchi Oxytocin (OT... -
Antibody Guide
TypeCollection...tissue sections are assayed and the extracellular matrix remains intact. The signaling molecule may be a..., cells have most or all of their extracellular matrix removed. Again, the signaling molecule may be a... -
Trends in CRISPR and SynBio Technologies
TypeBlog Post...on CRISPR technology, for example, the authors Patrick Hsu, Eric Lander, and Feng Zhang acknowledge the... -
Overwhelmed? Take a Break With Our 5 Favorite Science Comics
TypeBlog Post... “Unearthed Comics” by Sara Zimmerman 5) “Beatrice the Biologist” by Katie McKissick Sara Zimmerman... -
Bringing Renewable Energy to Addgene
TypeBlog Post... Patrick Stoney... -
What's New in CRISPR - Winter 2018
TypeBlog Post...the performance of different nucleases. Nicola Patron’s lab compared the efficiency and specificity of... -
Your Top Requested Plasmid in 2015!
TypeBlog Post...signaling in cancer cells, deciphering the mechanism of matrix metalloproteinase-9 secretion, and identifying ... -
How Exercise Purges Stress and Keeps Depression at Bay
TypeBlog Post... for a variety of brain disorders, including psychiatric and cognitive conditions as well as neurodegenerative... -
Q&A With Julie Cicalese, the Newest Member of the Addgene Board of Directors
TypeBlog Post...Leukemia Society, the Boston Marathon for the MGH Pediatric Oncology and the Chicago Marathon to benefit Neurofibromatosis... -
A new platform for fast functional characterization of potentially cancerous mutations
TypeBlog Post.... The possibilities are vast. References Ng, Patrick Kwok-Shing, et al. "Systematic functional annotation... -
CRISPR Protocol for Genomic Deletions in Mammalian Cell Lines [Video]
TypeBlog Post... you to our guest bloggers! Daniel Bauer is a pediatric hematologist and principal investigator at Boston... -
"What Makes a Good Mentor?" and 6 More FAQs About Science Mentoring
TypeBlog Post...Mentor Do I Want To Be?” In this excellent essay Acclimatrix, an assistant professor at a research university...