Skip to main content

We narrowed to 252 results for: p

Showing: 241 - 252 of 252 results
  1. Chemogenetics Guide

    Type
    Guide
    .... H. J., DiBerto, J. F., Giguere, P. M., Sassano, F. M., Huang, X. P., Zhu, H., Urban, D. J., White, K.../10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H. G., Falk, M. S., Chan, S. D., Meng, F.,...15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav, P. N., Daigle, T. L., Urban, D. J., Lee, H. M., Sciaky...Sciaky, N., Simmons, A., Nonneman, R. J., Huang, X. P., Hufeisen, S. J., Guettier, J. M., Moy, S. S., Wess...Bonaventura, J., Lesniak, W., Mathews, W. B., Sysa-Shah, P., Rodriguez, L. A., Ellis, R. J., Richie, C. T., Harvey...doi.org/10.1038/s43586-023-00276-1. Magnus, C. J., Lee, P. H., Atasoy, D., Su, H. H., Looger, L. L., & Sternson..., Y., Oyama, K., Ji, B., Takahashi, M., Huang, X. P., Slocum, S. T., DiBerto, J. F., Xiong, Y., Urushihata...
  2. Optogenetics Guide

    Type
    Guide
    ... M., Beyrière, F., Tsunoda, S. P., Mattis, J., Yizhar, O., Hegemann, P., & Deisseroth, K. (2008). Red-...Emiliani, V., Entcheva, E., Hedrich, R., Hegemann, P., Konrad, K. R., Lüscher, C., Mahn, M., Pan, Z. H....Wietek, J., Beltramo, R., Scanziani, M., Hegemann, P., Oertner, T. G., & Wiegert, J. S. (2015). An improved...R., Ramakrishnan, C., Huguenard, J. R., Hegemann, P., & Deisseroth, K. (2011). Neocortical excitation/...21796121 Yizhar, O., Fenno, L., Zhang, F., Hegemann, P., & Diesseroth, K. (2011). Microbial opsins: a family...
  3. Modular Cloning Guide

    Type
    Guide
    ...for protein secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). POMBOX MoClo YTK Yeast...MoClo-YTK toolkit for protein expression and secretion in P. pastoris (a.k.a. K. phaffii ). GoldenPiCS Kit Yeast...Sauer 62 plasmids for advanced strain engineering in P. pastoris (a.k.a. K. phaffii ), including overexpression... CRISPR/Cas9 mediated genome editing in the yeast P. pastoris (a.k.a. K. phaffii ). NT-CRISPR Plasmid ...
  4. Plan Your Experiment

    Type
    Guide
    ...27984732 Doman, J. L., Sousa, A. A., Randolph, P. B., Chen, P. J., & Liu, D. R. (2022). Designing and executing...CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system that enables...Dixit, A., Parnas, O., Li, B., Chen, J., Fulco, C. P., Jerby-Arnon, L., Marjanovic, N. D., Dionne, D., ...Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen, J. L., Hu, J. H., Maeder, M. L., Joung, ...
  5. Lentiviral Vector Guide

    Type
    Guide
    ...Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide....2016.17 PMID: 27110581 Naldini, L., Blömer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M....Sabatini, D. M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...12649500 Timms, R. T., Tchasovnikarova, I. A., & Lehner, P. J. (2018). Differential viral accessibility (DIVA...
  6. Adenovirus Guide

    Type
    Guide
    ...new window) Bulcha, J. T., Wang, Y., Ma, H., Tai, P. W. L., & Gao, G. (2021). Viral vector platforms within...Custers, J., Vellinga, J., Hendriks, J., Jahrling, P., Roederer, M., Goudsmit, J., Koup, R., & Sullivan...new window) Mendonça, S. A., Lorincz, R., Boucher, P., & Curiel, D. T. (2021). Adenoviral vector vaccine...in a new window) Rosewell, A., Vetrini, F., & Ng, P. (2011). Helper-dependent adenoviral vectors . Journal...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel, R. J., & Muzyczka, N. (...T., Inaba, T., Mizukami, H., Ozawa, K., & Colosi, P. (2004). The adenovirus E1A and E1B19K genes provide...Link opens in a new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary ...
  8. Science Guides

    Type
    Guide
    ...Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which form an...
  9. Sequencing Primers

    Type
    Guide
    ...vectors Forward Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element Reverse pTrcHis Forward GAGGTATATATTAATGTATCG...
  10. Immunology Research Plasmids and Resources

    Type
    Collection
    ... 2 J2, TCRGJ2 TRGJP T cell receptor gamma joining P JP, TCRGJP TRGJP1 T cell receptor gamma joining P1... External Resouces Immport : Bhattacharya S, Dunn P, Thomas CG, Smith B, Schaefer H, Chen J, Hu Z, Zalocusky...
  11. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...tac ALS, motor neuron disease Trina Schroer 75437 p-AAV-sh[SNCA] SNCA U6 Parkinson's Edward Burton 75637...Parkinson's James Trimmer 206726 LRRK2/Dardarin kinase p-Ser910 scFv [1D8] LRRK2 CMV Parkinson's James Trimmer...
  12. Molecular Biology Reference

    Type
    Guide
    ...Met M AUG Phenylalanine Phe F UUU, UUC Proline Pro P CCU, CCC, CCA, CCG Serine Ser S UCU, UCC, UCA, UCG...
Showing: 241 - 252 of 252 results