We narrowed to 322 results for: cloning

...self-labeling protein fusions as well as empty backbones to clone your own protein of interest. Fluorescence microscopy...

...Cancer Drug Resistance Checkout the RAS Pathway Clone Collection ...

... alleles may be warranted (20-30% of all tagged clones were bi-allelic in our hands). Take-home message...

...fluorescent protein like mCherry (find plasmids for cloning in our Fluorescent Proteins Empty Backbones Collection...

...infection/transfection efficiency, selecting desired clones, and making transgenic mice. ID Plasmid Description...

...researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single plasmid — though some... the desired edit experimentally and to isolate clones containing the desired edit (see: Validate genetic...designed in silico and synthesized (Figure 8A), then cloned in a pooled format into lentiviral transfer vectors...PAM sequence in the genomic DNA. This sequence is cloned into a gRNA expression plasmid but does NOT include...

...chromatin accessibility across different cell types and cloned into an AAV backbone. Most enhancers were derived...

...Reagents Adherent HEK293T cells (ideally AAV-293T clones) Pro-Tip While adherent, these cells are very loosely...

...Addgene Resource(s) Cloning Plasmids Used to facilitate the cloning of DNA fragments. Cloning vectors tend to...optimized to help in the initial cloning of a DNA fragment. Commonly used cloning vectors include Gateway entry...entry vectors and TOPO cloning vectors. Empty Backbones , Cloning Kits Expression Plasmids Used for gene...molecule is known as DNA or molecular cloning. The advent of molecular cloning enabled scientists to break chromosomes...about different types of cloning methods, check out our guide on molecular cloning techniques . Common Bacteria...Plasmids Plasmid Elements Types of Plasmids Molecular Cloning Common E. coli Strains Common Antibiotics DNA Sequencing...molecular biology resources, including: Molecular Cloning Techniques Promoters Sequencing Primers Origins...

...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...Plasmid? Genetic Code Strain Information Molecular Cloning Techniques Protocols Find written and video protocols...

...plasmids. Gamma-Retroviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...

...lentiviral plasmids. Lentiviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...Molecular Biology Reference . Production After cloning, you will need to produce the lentiviral vectors ...Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production Generating...

...helper virus. Adenoviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...production. In AdEasy™, the transgene of interest is cloned into the shuttle plasmid, verified, and linearized...

...using standard restriction-ligation cloning. However, the exact cloning strategy will depend on the gRNA ...including selecting the edit type, designing and cloning a gRNA, delivering Cas and the gRNA, and validating...Introduction Select Genetic Manipulation Design and Clone gRNA Select Expression and Delivery Validate Genetic...the multi-plasmid SAM system Activate Design and Clone Your gRNA Achieving your desired edit comes down...few factors to keep in mind when designing and cloning your gRNAs. Select Genetic Element to be Targeted... about how to design your gRNA . Synthesize and Clone Desired gRNAs Once your target sequences are selected...selected, it’s time to design your gRNA oligos and clone them into your desired vector. In many cases, you...

...rAAV vector production. AAV Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...

...nomenclature, and uses to common promoters and cloning techniques! Close About Overlay Select CRISPR 101...

...of one clone that are specific to a certain epitope, or polyclonal, meaning there are many clones that ...antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into... bind to any given antigen. A mature B cell can clone itself to enable higher production of a single antibody...where each culture should produce the same antibody clone, or from plasmid-based expression. Monoclonal antibodies...

...origin Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE...

...MXS-chaining kit includes chaining vectors with multiple cloning sites and standardized building blocks: 14 different...kinases and kinase-related open reading frames (ORFs) cloned into a retroviral vector which adds a myristoylation...

...researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single plasmid — though some... the desired edit experimentally and to isolate clones containing the desired edit (see: Validate genetic...designed in silico and synthesized (Figure 8A), then cloned in a pooled format into lentiviral transfer vectors...PAM sequence in the genomic DNA. This sequence is cloned into a gRNA expression plasmid but does NOT include...