Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 326 results for: cloning

Showing: 301 - 320 of 326 results

  2. Pouring LB Agar Plates

    Type
    Protocol
    ...like... Plasmids 101 Blog Posts Mol Bio Protocols Cloning Protocols Introduction Plasmids can carry one or...

  3. CRISPR Guide

    Type
    Collection
    ...researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single plasmid — though some... the desired edit experimentally and to isolate clones containing the desired edit (see: Validate genetic...designed in silico and synthesized (Figure 8A), then cloned in a pooled format into lentiviral transfer vectors...PAM sequence in the genomic DNA. This sequence is cloned into a gRNA expression plasmid but does NOT include...

  5. AAV Production in HEK293 Cells

    Type
    Protocol
    ...Reagents Adherent HEK293T cells (ideally AAV-293T clones) Pro-Tip While adherent, these cells are very loosely...bicarbonate, Corning 25-035-CI (optional) 1 M HEPES, HyClone SH30237.01 (optional) L-alanyl-L-glutamine (or...

  6. Cloning

    Type
    Guide
    ... a Molecular Cloning Technique Molecular Cloning Techniques You may also like... Cloning Resources Empty...101: Restriction cloning ) Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid...Plasmid 101: Gateway Cloning ) Gateway® cloning is a recombination based cloning method. The benefit of ...via gateway cloning. Back to Top TOPO® Cloning TOPO (Image from Plasmid 101: TOPO Cloning ) Toposiomerase...Toposiomerase based cloning, often called TOPO® cloning or TA cloning, is a method that relies on the hybridization...MoClo and Golden Gate cloning kits for your next cloning project. Golden Gate Cloning (Image from Plasmid...Golden Gate Cloning ) Back to Top Ligation Independent Cloning Ligation Independent Cloning (LIC) relies...

  7. Molecular Biology Reference

    Type
    Guide
    ...plasmid types: Cloning Plasmids - Used to facilitate the cloning of DNA fragments. Cloning vectors tend ...thus termed clones of the original cell. The plasmid DNA is similarly referred to as cloned DNA, and this... is known as DNA or molecular cloning . The process of molecular cloning enabled scientists to break chromosomes...about different types of cloning methods check out our guide on molecular cloning techniques . Plasmid Elements...optimized to help in the initial cloning of a DNA fragment. Commonly used cloning vectors include Gateway entry... help you choose the right cloning method Plasmids 101: Restriction Cloning Plasmids 101: Inducible Promoters...as genes. Creation of recombinant DNA Molecular Cloning Plasmids that are used most commonly in the field...

  8. Educational Resources

    Type
    Guide
    ...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...Plasmid? Genetic Code Strain Information Molecular Cloning Techniques Protocols Find written and video protocols...

  9. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...BioRender.com. Gamma-Retroviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...

  10. Lentiviral Vector Guide

    Type
    Guide
    ...lentiviral plasmids. Lentiviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...Molecular Biology Reference . Production After cloning, you will need to produce the lentiviral vectors ...Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production Generating...

  11. Adenovirus Guide

    Type
    Guide
    ...BioRender.com. Adenoviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...production. In AdEasy™, the transgene of interest is cloned into the shuttle plasmid, verified, and linearized...

  12. Plan Your Experiment

    Type
    Guide
    ...using standard restriction-ligation cloning. However, the exact cloning strategy will depend on the gRNA ...targeted region from DNA, subcloning into a plasmid, and screening individual clones. PCR amplification and...your gRNA . Browse Plasmids: gRNAs Synthesize and clone desired gRNAs Once you have selected your target...sequences it is time to design your gRNA oligos and clone these oligos into your desired vector. In many cases...whether the edit was successful. PCR amplification, subcloning and Sanger sequencing (for HDR or NHEJ): Provides...

  13. Hot Plasmids - May 2022

    Type
    Blog Post
    ... own subclone, they were able to develop a 12-plex multiplex imaging system. Mixing the subclones within...their work with the “signalome,” a 12-plex mixed-subclone system using mStrawberry, localization peptides...

  14. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... with BioRender.com. AAV Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...

  15. Antibody Guide

    Type
    Guide
    ...of one clone that are specific to a certain epitope, or polyclonal, meaning there are many clones that ...antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into... bind to any given antigen. A mature B cell can clone itself to enable higher production of a single antibody...where each culture should produce the same antibody clone, or from plasmid-based expression. Monoclonal antibodies...

  16. Addgene's eBook Collection

    Type
    Guide
    ...nomenclature, and uses to common promoters and cloning techniques! Close About Overlay Select CRISPR 101...

  19. Sequencing Primers

    Type
    Guide
    ...forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC...

  20. CRISPR Guide

    Type
    Guide
    ...researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single plasmid — though some... the desired edit experimentally and to isolate clones containing the desired edit (see: Validate genetic...designed in silico and synthesized (Figure 8A), then cloned in a pooled format into lentiviral transfer vectors...PAM sequence in the genomic DNA. This sequence is cloned into a gRNA expression plasmid but does NOT include...
Showing: 301 - 320 of 326 results