Skip to main content

We narrowed to 60 results for: luciferase

Showing: 31 - 60 of 60 results
  1. Plasmids 101: Control Plasmids

    Type
    Blog Post
    ...constitutively expresses a reporter protein (e.g., GFP or luciferase) that is either co-transfected with the test ...
  2. Retrovirus Plasmids

    Type
    Collection
    ...Clevers 18760 MSCV IRES Luciferase MSCV Plasmid for transgene expression with luciferase expression. Scott ...Sun 60683 pLXIN-Luc MoMSV Stable expression of luciferase in mammalian cells. Alice Wong 83356 pMXs-3XHA-EGFP-OMP25...
  3. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ... genomic engineering Luciferase Reporter pGL3 Basic Vector - Firefly luciferase vector for investigating... to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...investigating regions controlling transcription See our Luciferase collection of plasmid backbones into which you...target genes can be inserted into this firefly luciferase reporter to test for their effects on protein...
  4. Zhang Lab CRISPR Page

    Type
    Collection
    ...to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA cloning backbone with luciferase-2A-Cre recombinase...sgRNAs targeting KRAS , p53 , and LKB1 , plus luciferase-2A-Cre recombinase, and Kras G12D HDR template...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and sgRNAs targeting the mouse...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA targeted to LacZ...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA backbone for ...
  5. Chemogenetics Plasmids

    Type
    Collection
    ...luminescent opsins: fusion proteins of a light-emitting luciferase and a light-sensing optogenetic element such ...such as channelrhodopsin. When the luciferase enzyme oxidizes its substrate (luciferin), it generates light...
  6. Bacterial Expression Systems

    Type
    Collection
    ...transcription factors. Addgene Blog Luciferase Technologies Enabled by NanoLuc® Luciferase Fluorescent Biosensors ...easily measurable reporter genes (e.g., LacZ, luciferase, or fluorescent proteins) under the control of...FFluc Promoter activity Luminescence (firefly luciferase) Mycobacterium sp. Brian Robertson , Siouxsie...
  7. Fluorescent Protein Guide

    Type
    Collection
    ...receptors that affect cell signalling pathways. Luciferase Plasmids Use bioluminescent reporters for studying...
  8. Fluorescent Proteins: FRET

    Type
    Collection
    ...Read more about self-labeling tags on our blog . Luciferase can be paired with a fluorescent protein acceptor...Resonance Energy Transfer (BRET) . Browse Addgene's Luciferase Plasmid Collection or the Promega Plasmid Collection...
  9. Lentivirus Plasmids

    Type
    Collection
    ...pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase 3rd Expression of EGFP-Firefly luciferase fusion protein. Ethan Abel...
  10. Plasmid Collections

    Type
    Collection
    ...Zinc Fingers Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus...
  11. Chemogenetics Guide

    Type
    Guide
    ...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin...luciferin) is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...increased efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome Reference LMO3 sbGLuc...
  12. Sequencing Primers

    Type
    Guide
    ...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...
  13. Molecular Biology Reference

    Type
    Guide
    ...These plasmids contain a reporter gene (e.g., luciferase or GFP) that offers a readout of the activity...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...that promoter. Fluorescent Protein Plasmids , Luciferase Plasmids Viral Plasmids These plasmids are modified...
  14. Optogenetics Guide

    Type
    Guide
    ...-emitting luciferase fused to a light-sensing element such as an opsin. When the luciferase substrate ...substrate is added, the luciferase enzyme generates light that activates the opsin. While LMOs can also be activated...
  15. COVID-19 Resources

    Type
    Collection
    ... pseudotyped virus. It also lists several luciferase and fluorescent reporter plasmids that have been...
  16. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214673 lucMAPT-30U MAPT T5, luciferase CMV Parkinson's...237836 OPTN-P1 OPTN Luciferase PGK ALS Angela Ting 237837 OPTN-P2 OPTN Luciferase PGK ALS Angela Ting ...FTD Eugene Yeo 214674 lucMAPT-GenRep MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214814 U6_ ATM_G101...
  17. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40 Control James M. Wilson AV-1-PV1917 105541...James M. Wilson AV-8-PV0105 105532-AAV8 pAAV.CMV.ffLuciferase.SV40 Control James M. Wilson AV-8-PV0146 105535...Karl Deisseroth AV-5-PV0105 105532-AAV5 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-5-PV1090 105537-AAV5... M. Wilson AV-8-PV1302 105538-AAV8 pENN.AAV.TBG.PI.ffLuciferase.RBG James M. Wilson AV-8-PV3637 65015-...Karl Deisseroth AV-9-PV0105 105532-AAV9 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-9-PV0109 105533-AAV9...Karl Deisseroth AV-2-PV0105 105532-AAV2 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-1-PV3365 105554-AAV1...
  18. Control AAV Preps

    Type
    Collection
    ... 5, 8 James M. Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 8 James M. Wilson...
Showing: 31 - 60 of 60 results