We narrowed to 1,143 results for: Gene
-
TypeProtocol...short region of DNA: guide RNAs targeting different genes in an organism's genome, for example. Amplification...Molecular Biology Reference How do I process my Addgene pooled library? Introduction Please refer to our...depositor for a specific pooled library available at Addgene. We recommend following the depositor's specific...amplification. This protocol is designed to be as general as possible but note that individual libraries ...results. If you obtained the pooled library from Addgene, these protocols can be found on the Pooled Library...our protocol on Bacterial Transformation . The generalized pooled library amplification protocol is expected... a diagnostic digest and high-throughput next generation sequencing (NGS). Select a restriction enzyme...
-
AAV Production in HEK293 Cells
TypeProtocol... pHelper; pRC (Rep-Cap), plasmid expressing your gene of interest Triton X-100 Benzonase/DNAse I (Millipore... 0.45 μm polyethersulfone (PES) filter system, Nalgene, 565-0010 (or for larger volumes 1000 mL 0.45 µm... µm Rapid-Flow PES Filtration Unit, Nalgene 167-0045) Pro-Tip Do not use filters made of materials other... -
Lentiviral Vector Guide
TypeGuide...strand of RNA contains packaging genes, regulatory genes, accessory genes, and the long-terminal repeats...shRNA , and overexpressing of oncogenes and other disease-associated genes. Gene Therapy Due to their relative...complex genomes, containing packaging genes and accessory genes specific to each virus type, while retroviruses...require the regulatory genes tat and rev , along with virus-specific accessory genes (for example, vif , ...Packaging plasmid — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated into two... envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope gene, as it has...two plasmids in third generation systems Envelope plasmid — contains packaging gene env (usually VSV-G due... -
Gamma-Retroviral Vector Guide
TypeGuide...the necessary packaging genes, while lentiviruses also contain accessory genes specific to each virus ...common packaging genes gag , pol , and env . The LTRs flank all of these required genes, and anything in...— contains packaging genes gag and pol Envelope plasmid — contains packaging gene env ; usually VSV-G ... envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope gene, as it has...commonly used in gene therapy applications to more specifically direct delivery of gene therapies. Common...gamma-retroviral vectors. Gene Therapy Gamma-retroviral vectors are a popular choice in gene therapy applications...production, in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans ... -
Adeno-associated virus (AAV) Guide
TypeGuide...capacity for long-term gene expression. These features make them ideal for gene therapy, neuroscience ...biomedical fields. Gene Therapy One of the major applications of rAAV vectors is in the field of gene therapy to...virus (AAV) as novel vectors for human gene therapy . Current Gene Therapy, 3 (4), 281–304. https://doi....the two ITRs with a gene expression cassette that typically contains the transgene of interest. The size...vectors to deliver genes to cells in in vivo models. For more detailed protocols, see Addgene’s Viral Vector...host genome can have on transgene expression and the expression of neighboring genes. rAAV episomes can develop... and the low risk of insertional mutagenesis. Several AAV-based gene therapies have been approved by the... -
Molecular Biology Reference
TypeGuide...bacterial populations, an antibiotic resistance gene (i.e., a gene whose product confers resistance to ampicillin...transcription. Gene Knock-down Plasmids - Used for reducing the expression of an endogenous gene. This is frequently...chromosomes down to study their genes, marking the birth of molecular genetics. Today, scientists can easily...easily study and manipulate genes and other genetic elements using specifically engineered plasmids, commonly...when a gene is inserted within the MCS, its expression will be driven by the promoter. As a general rule...the gene, promoter, or other DNA fragment cloned into the MCS. The insert is typically the genetic element...experiment, see Addgene's empty backbone page for more information. Expression Plasmids - Used for gene expression... -
Adenovirus Guide
TypeGuide...provide a large transgene packaging capacity. Large protein-coding genes and complex gene expression cassettes...(2017). Adenovirus-mediated gene delivery: potential applications for gene and cell-based therapies in..., subsequent generations of rAdV vectors have been developed where more adenoviral genes have been removed...containing the adenoviral genes necessary for viral production. In AdEasy™, the transgene of interest is cloned...containing the transgene of interest, and the adenoviral plasmid containing the adenoviral genes necessary ...second and third-generation vectors. This capacity is large enough to carry the Cas9 gene and a gRNA expression...Helper-dependent adenoviral vectors . Journal of Genetic Syndromes & Gene Therapy, Suppl 5 , 001. https://doi.org... -
Promoters
TypeGuide...complex systems of gene regulation, like operons. Operons are a cluster of different genes that are controlled...transcription of genes. There are three types of RNA polymerases that all transcribe different genes. RNA polymerase...promoter is a region of DNA where transcription of a gene is initiated. Promoters are a vital component of...region controls when and where in the organism your gene of interest is expressed. Summary Promoters are ...of the sense or coding strand of the transcribed gene. The coding strand is the DNA strand that encodes...transcription. The most 3' portion (closest to the gene's start codon) of the core promoter is the TSS which...DNA sequences can affect transcription of a given gene. The TATA-binding protein binds the TATA box and... -
Guide to Using Pooled Libraries
TypeGuide...target gene. Positive selection screens are generally very robust, and tens of thousands of genes that ...contains a unique gene targeting sequence, but there are multiple sequences targeting each gene in the overall... multiple genes at once. A well-designed screen can help you begin to understand what genes are important...powerful tool for forward genetic screening, or identifying previously unknown genes that contribute to a ...list of genes involved in the selection NEGATIVE screen: Apply library Perform Next Generation Sequencing...identify genes that are essential for growth/survival under certain conditions. Next-Generation Sequencing... backbone, but they express or target different genes. Some libraries cover the majority of the genome... -
Sequencing Primers
TypeGuide...In lacZ gene M13 (-40) GTTTTCCCAGTCACGAC In lacZ gene M13 Reverse CAGGAAACAGCTATGAC In lacZ gene M13/pUC...Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG...resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, reverse ...reverse primer M13 Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine...ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG...GGGTTTTATTAACTTACAT (Vosshall lab) 5' end of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG... -
CRISPR Guide
TypeGuide... editing multiple genes at once; using dual nickases to generate a knockout or gene edit; or using Cas9...the targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the...eliminate target gene function. It has also been used extensively to screen for novel genes that regulate... activate, or repress genes. Each library typically contains ∼3–6 gRNAs per gene to ensure modification...repress, visualize, and isolate genes. Activation or Repression of Target Genes Figure 9: Overview of CRISPRi...highest levels of single-gene activation (Figure 9D) In bacteria, activating gene expression is more difficult... of effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have... -
Plan Your Experiment
TypeGuide...mutant allele of a gene (point mutant)? Increase or decrease expression of a target gene? Once you have a...want to: Generate complete and permanent loss of gene expression or function (knockout)? Generate a specific...cloning your gRNAs. Select Genetic Element to be Targeted The exact region of the gene you target will depend...Considerations Browse Plasmids Knockout Permanently disrupt gene function; cells will use error-prone non-homologous...Prime Edit Repress or Interfere (CRISPRi) Reduce gene expression without permanently modifying the genome...cell lines Interfere Activate (CRISPRa) Increase gene expression without permanently modifying the genome...Intereference : Target the promoter region of the gene of interest, where the Cas9 protein can block transcription... -
Chemogenetics Guide
TypeGuide...receptor to engineer a receptor-effector complex for gene therapy. J Biol Chem. 276:1596-6. PMID: 11402033...Guides Chemogenetics Guide Chemogenetics Guide Jump To: Chemogenetics Guide Early Chemogenetic Receptors...to. To find chemogenetics plasmids available through Addgene, check out our Chemogenetics Plasmid Collection...Collection . Figure 1: General overview of a chemogenetics experiment. Early Chemogenetic Receptors: RASSLs...Addgene's guide to using Chemogenetics plasmids in your lab for interrogation of neuronal activity. Science...opto-chemogenetic fusion proteins of a light-emitting luciferase and a light-sensing optogenetic element...biophysical properties. While LMOs provide chemogenetic access to optogenetic tools, they also retain the ability... -
Optogenetics Guide
TypeGuide...pDusk Blue-light photoreceptor for light-controlled gene expression. These plasmids rely on the engineered... Science Guides Optogenetics Guide Optogenetics Guide Jump To: Optogenetics Guide Introduction Microbial...Collection . To find optogenetics plasmids available through Addgene, check out our Optogenetics Plasmid Collection...Addgene's guide to using Optogenetics plasmids in your lab, including explanations of microbial opsin...References Introduction The field of optogenetics integrates optics and genetic engineering to measure and manipulate...from Kir2.1 540 Plan Your Optogenetics Experiment When designing your optogenetics experiment, you’ll need...are some key factors to consider: Optogenetic excitation or optogenetic inhibition. First things first: ... -
Addgene's eBook Collection
TypeGuide...start or need a handy reference, Addgene's eBooks are here to help!... Addgene's eBook Collection When you're...sure where to start or need a handy reference, Addgene's eBooks are here to help! 0 of 0 Selected Download... -
Cloning
TypeGuide... your gene of interest one time into a donor plasmid (or acquire one that already has your gene into it...molecular cloning scientists can amplify and manipulate genes of interest and then insert them into plasmids for...digests on our website. Restriction cloning of your gene of interest (YGOI) into a recipient plasmid. (Image...Addgene's reference guide on molecular cloning techniques, including information on seven commonly used...exonuclease digests the 5' end of dsDNA fragments to generate 3' single-stranded overhangs. DNA polymerases ... chews back the 5’ ends of your DNA fragments generating long overhangs that anneal to each other due ...to assemble before you get started. Check out Addgene's website for easy to use MoClo and Golden Gate ... -
Science Guides
TypeGuide... backbone, but they express or target different genes. Some libraries cover the majority of the genome...genome, while others are restricted to certain gene sets. Read More Viral Vectors Find educational guides ...interest. Read More Chemogenetics Chemogenetics is a technique that uses genetically engineered receptors... experiment. Read More Optogenetics Optogenetics integrates optics and genetic engineering to measure ...links to the guides below. Antibodies Chemogenetics CRISPR Optogenetics Pooled Libraries Viral Vectors Antibodies... Science Guides Addgene has created the following guides to help you start...processes. The tools and technologies developed for optogenetics research utilize light to detect, measure, and... -
Isolating a Monoclonal Cell Population by Limiting Dilution
TypeProtocol...Blog Posts Addgene Protocols Viral Service Introduction This protocol describes how to generate a monoclonal...Selective pressure on this heterogeneous cell pool could lead to reduced transgene expression over time, as...more likely to retain stable transgene expression. Other methods of generating a monoclonal cell line include...for generating stable cell lines with lentivirus . Day 0: (optional) Seed cells for the generation of ...highest or lowest transgene expression ( Figure 2 ). Sample Data Figure 1: Generation of monoclonal cell...This protocol describes how to generate a monoclonal cell line from a polyclonal pool of stable cells...expressing clones take over the polyclonal cell pool. Generating a monoclonal cell line by limiting dilution results... -
Video Library
TypeProtocol... Educational Resources Addgene Videos Addgene Videos Browse Addgene's collection of video content...using Addgene's resources, and career advice. For written lab protocol material, visit our Addgene Protocols...Storing and Handling Addgene Plasmids What to do after you receive your plasmids from Addgene Instructions for...samples from Addgene Technology Transfer How to Order A step-by-step walkthrough of Addgene's ordering process...this first installment of the Addgene Careers series, we sit down with Addgene Outreach Scientist Jessica...she loves about working at Addgene! Maria Soriano Maria Soriano, from Addgene's UK office, discusses her...A collection of Addgene's video content, including how-to screen captures, lab procedure protocols, and... -
AAV ddPCR Titration
TypeProtocol... master mix preparation and droplet generation (droplet generation BSC) to ensure no contamination of ...cap the PCR tubes. Generate the Droplets Bring the PCR tubes to the droplet generation BSC. Without disturbing...holder to the droplet generator. Close the lid and wait for the droplets to be generated. Once the droplets...12–5E+13 GC/mL, where GC is genome copies and generally represents the physical number of viral particles...surfaces with 10% bleach. Safety Warnings AAV is generally considered biosafety level 1 but may require BSL...Molecular Biology Grade Water, Hyclone, SH30538.02 GeneAmp 10X PCR Buffer, Applied Biosystems, N8080129 ddPCR...Pluronic F-68, Thermo Fisher, 24040032 Droplet generation oil, Bio-Rad, 1863005 DG8 cartridge, Bio-Rad,...