Skip to main content

We narrowed to 1,147 results for: Gene

Showing: 21 - 40 of 1147 results
  1. CRISPR Library Amplification

    Type
    Protocol
    ...short region of DNA: guide RNAs targeting different genes in an organism's genome, for example. Amplification...Molecular Biology Reference How do I process my Addgene pooled library? Introduction Please refer to our...depositor for a specific pooled library available at Addgene. We recommend following the depositor's specific...amplification. This protocol is designed to be as general as possible but note that individual libraries ...results. If you obtained the pooled library from Addgene, these protocols can be found on the Pooled Library...our protocol on Bacterial Transformation . The generalized pooled library amplification protocol is expected... a diagnostic digest and high-throughput next generation sequencing (NGS). Select a restriction enzyme...
  2. AAV Production in HEK293 Cells

    Type
    Protocol
    ... pHelper; pRC (Rep-Cap), plasmid expressing your gene of interest Triton X-100 Benzonase/DNAse I (Millipore... 0.45 μm polyethersulfone (PES) filter system, Nalgene, 565-0010 (or for larger volumes 1000 mL 0.45 µm... µm Rapid-Flow PES Filtration Unit, Nalgene 167-0045) Pro-Tip Do not use filters made of materials other...
  3. Lentiviral Vector Guide

    Type
    Guide
    ...strand of RNA contains packaging genes, regulatory genes, accessory genes, and the long-terminal repeats...shRNA , and overexpressing of oncogenes and other disease-associated genes. Gene Therapy Due to their relative...complex genomes, containing packaging genes and accessory genes specific to each virus type, while retroviruses...require the regulatory genes tat and rev , along with virus-specific accessory genes (for example, vif , ...Packaging plasmid — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated into two... envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope gene, as it has...two plasmids in third generation systems Envelope plasmid — contains packaging gene env (usually VSV-G due...
  4. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...the necessary packaging genes, while lentiviruses also contain accessory genes specific to each virus ...common packaging genes gag , pol , and env . The LTRs flank all of these required genes, and anything in...— contains packaging genes gag and pol Envelope plasmid — contains packaging gene env ; usually VSV-G ... envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope gene, as it has...commonly used in gene therapy applications to more specifically direct delivery of gene therapies. Common...gamma-retroviral vectors. Gene Therapy Gamma-retroviral vectors are a popular choice in gene therapy applications...production, in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans ...
  5. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...capacity for long-term gene expression. These features make them ideal for gene therapy, neuroscience ...biomedical fields. Gene Therapy One of the major applications of rAAV vectors is in the field of gene therapy to...virus (AAV) as novel vectors for human gene therapy . Current Gene Therapy, 3 (4), 281–304. https://doi....the two ITRs with a gene expression cassette that typically contains the transgene of interest. The size...vectors to deliver genes to cells in in vivo models. For more detailed protocols, see Addgene’s Viral Vector...host genome can have on transgene expression and the expression of neighboring genes. rAAV episomes can develop... and the low risk of insertional mutagenesis. Several AAV-based gene therapies have been approved by the...
  6. Molecular Biology Reference

    Type
    Guide
    ...promoter to drive expression of the inserted gene. Insert The gene, promoter, or other DNA fragment cloned ...Expression Plasmids Used for gene expression, usually for the purposes of gene study. Expression vectors ... Backbones Gene Knock-down Plasmids Used for reducing the expression of an endogenous gene. This is frequently...Sequencing Primers Origins of Molecular Genetics The concept of genes as carriers of phenotypic information...scientists can easily study and manipulate genes and other genetic elements using specifically engineered ...studying the function of genetic elements. These plasmids contain a reporter gene (e.g., luciferase or GFP...chromosomes down to study their genes, marking the birth of molecular genetics. To learn more about different...
  7. Adenovirus Guide

    Type
    Guide
    ...provide a large transgene packaging capacity. Large protein-coding genes and complex gene expression cassettes...(2017). Adenovirus-mediated gene delivery: potential applications for gene and cell-based therapies in..., subsequent generations of rAdV vectors have been developed where more adenoviral genes have been removed...containing the adenoviral genes necessary for viral production. In AdEasy™, the transgene of interest is cloned...containing the transgene of interest, and the adenoviral plasmid containing the adenoviral genes necessary ...second and third-generation vectors. This capacity is large enough to carry the Cas9 gene and a gRNA expression...Helper-dependent adenoviral vectors . Journal of Genetic Syndromes & Gene Therapy, Suppl 5 , 001. https://doi.org...
  8. Sequencing Primers

    Type
    Guide
    ...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Reverse CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward...CCCAGTCACGACGTTGTAAAACG In lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MSCV Forward...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Forward (-40) GTTTTCCCAGTCACGAC In lacZ gene Forward M13 Reverse ...CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG In lacZ gene Forward M13/pUC Reverse...neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F...puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse pZIP...ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene Reverse AUG1 Forward CAATTTACATCTTTATTTATTAACG For...
  9. Promoters

    Type
    Guide
    ...complex systems of gene regulation, like operons. Operons are a cluster of different genes that are controlled... actin 5c gene Gal4/UAS Specific Insect Requires UAS regulatory element and yeast Gal4 gene; often used...transcription of genes. There are three types of RNA polymerases that all transcribe different genes: RNA polymerase...promoter is a region of DNA where transcription of a gene is initiated. Promoters are a vital component of...region controls when and where in the organism your gene of interest is expressed. Promoters are about 100...of the sense or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand ...repressor or activator can bind), and the structural genes that are transcribed together. Operon regulation...
  10. Guide to Using Pooled Libraries

    Type
    Guide
    ...target gene. Positive selection screens are generally very robust, and tens of thousands of genes that ...contains a unique gene targeting sequence, but there are multiple sequences targeting each gene in the overall... multiple genes at once. A well-designed screen can help you begin to understand what genes are important...powerful tool for forward genetic screening, or identifying previously unknown genes that contribute to a ...list of genes involved in the selection NEGATIVE screen: Apply library Perform Next Generation Sequencing...identify genes that are essential for growth/survival under certain conditions. Next-Generation Sequencing... backbone, but they express or target different genes. Some libraries cover the majority of the genome...
  11. CRISPR Guide

    Type
    Guide
    ... editing multiple genes at once; using dual nickases to generate a knockout or gene edit; or using Cas9...the targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the...eliminate target gene function. It has also been used extensively to screen for novel genes that regulate... activate, or repress genes. Each library typically contains ∼3–6 gRNAs per gene to ensure modification...repress, visualize, and isolate genes. Activation or Repression of Target Genes Targeting dCas9 to transcription...single-gene activation (Figure 9D) Figure 9: Overview of CRISPRi/a. In bacteria, activating gene expression... of effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have...
  12. Modular Cloning Guide

    Type
    Guide
    ...building synthetic genetic circuits, engineering metabolic pathways, assembling gene-editing tools, and...-YTK (Dueber) for genetic engineering of S. cerevisiae , enabling larger multi-gene constructs, multiplexed...Pluskal Plasmid kit for assembly of single-gene and multigene plasmids for genome integration in fission...Bacterial Expression Thomas Lahaye Plasmids to generate gene knockout and complementation constructs for ...promoter, a 5' UTR, a signal peptide, a protein-coding gene, and a terminator, as in Figure 1). Next, up to ...Cloning System (Lohmann) to create plasmids with multi-gene constructs for plant transformation. GoldenBraid...plant transformation vectors for overexpression, gene editing, functional genomics, and more complex metabolic...
  13. Plan Your Experiment

    Type
    Guide
    ...mutant allele of a gene (point mutant)? Increase or decrease expression of a target gene? Once you have a...want to: Generate complete and permanent loss of gene expression or function (knockout)? Generate a specific...cloning your gRNAs. Select Genetic Element to be Targeted The exact region of the gene you target will depend...Considerations Browse Plasmids Knockout Permanently disrupt gene function; cells will use error-prone non-homologous...Prime Edit Repress or Interfere (CRISPRi) Reduce gene expression without permanently modifying the genome...cell lines Interfere Activate (CRISPRa) Increase gene expression without permanently modifying the genome...Intereference : Target the promoter region of the gene of interest, where the Cas9 protein can block transcription...
  14. Chemogenetics Guide

    Type
    Guide
    ...Guides Chemogenetics Guide Chemogenetics Guide Jump To: Chemogenetics Guide Early Chemogenetic Receptors...explore Addgene's Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment...Addgene's guide to using Chemogenetics plasmids in your lab for interrogation of neuronal activity. Science...experiment. Early Chemogenetic Receptors: RASSLs The first chemogenetic receptors were based on G-protein...opto-chemogenetic fusion proteins of a light-emitting luciferase and a light-sensing optogenetic element...biophysical properties. While LMOs provide chemogenetic access to optogenetic tools, they also retain the ability...thereof (FFz, CFz). Learn more about optogenetic systems in our Optogenetics Guide . Figure 4: Luminopsins can...
  15. Optogenetics Guide

    Type
    Guide
    ...pDusk Blue-light photoreceptor for light-controlled gene expression. These plasmids rely on the engineered... Science Guides Optogenetics Guide Optogenetics Guide Jump To: Optogenetics Guide Microbial Opsins...learn more, or explore Addgene's Optogenetics Plasmid Collection . An optogenetics procedure. A channelrhodopsin...tools through directed mutagenesis. Find optical switches in Addgene's Optogenetics Plasmid Collection for...Addgene's guide to using Optogenetics plasmids in your lab, including explanations of microbial opsin...Experiment References The field of optogenetics integrates optics and genetic engineering to manipulate cells...past, the field of optogenetics was considered to include both actuators (genetically-encoded tools for...
  16. Addgene's eBook Collection

    Type
    Guide
    ...start? Need a quick reference? Addgene's eBooks are here to help!... Addgene's eBook Collection Not sure where...where to start? Need a quick reference? Addgene's eBooks are here to help! 0 of 0 Selected Download Select...
  17. Molecular Cloning Techniques

    Type
    Guide
    ...clone your gene of interest one time into a donor plasmid or acquire one that already has your gene in it.... cloning, scientists can amplify and manipulate genes of interest and then insert them into plasmids for...post . Figure 1: Restriction enzyme cloning of your gene of interest (insert) into a plasmid backbone. Created... the thousands of entry vectors deposited with Addgene), it can be rapidly shuttled into any compatible...project has been completed via Gateway cloning. Addgene's collection contains thousands of Gateway donor...chews back the 5’ ends of your DNA fragments, generating long overhangs that anneal to each other due ...to assemble before you get started. Check out Addgene's website for easy-to-use MoClo and Golden Gate ...
  18. Science Guides

    Type
    Guide
    ... backbone, but they express or target different genes. Some libraries cover the majority of the genome...genome, while others are restricted to certain gene sets. Read More Viral Vectors Find educational guides ...interest. Read More Chemogenetics Chemogenetics is a technique that uses genetically engineered receptors... experiment. Read More Optogenetics Optogenetics integrates optics and genetic engineering to measure ...links to the guides below. Antibodies Chemogenetics CRISPR Optogenetics Pooled Libraries Viral Vectors Antibodies... Science Guides Addgene has created the following guides to help you start...processes. The tools and technologies developed for optogenetics research utilize light to detect, measure, and...
  19. Isolating a Monoclonal Cell Population by Limiting Dilution

    Type
    Protocol
    ...Blog Posts Addgene Protocols Viral Service Introduction This protocol describes how to generate a monoclonal...Selective pressure on this heterogeneous cell pool could lead to reduced transgene expression over time, as...more likely to retain stable transgene expression. Other methods of generating a monoclonal cell line include...for generating stable cell lines with lentivirus . Day 0: (optional) Seed cells for the generation of ...highest or lowest transgene expression ( Figure 2 ). Sample Data Figure 1: Generation of monoclonal cell...This protocol describes how to generate a monoclonal cell line from a polyclonal pool of stable cells...expressing clones take over the polyclonal cell pool. Generating a monoclonal cell line by limiting dilution results...
  20. Video Library

    Type
    Protocol
    ...Resources Addgene Videos Addgene Videos Protocols How-To Videos Career Videos Browse Addgene's collection...using Addgene's resources, and career advice. For written lab protocol material, visit our Addgene Protocols...Storing and Handling Addgene Plasmids What to do after you receive your plasmids from Addgene Instructions for...samples from Addgene Technology Transfer How to Order A step-by-step walkthrough of Addgene's ordering process...this first installment of the Addgene Careers series, we sit down with Addgene Outreach Scientist Jessica...she loves about working at Addgene! Maria Soriano Maria Soriano, from Addgene's UK office, discusses her...A collection of Addgene's video content, including how-to screen captures, lab procedure protocols, and...
Showing: 21 - 40 of 1147 results