...Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes... 60719 activate S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes...

...none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm EcoRI none S. pyogenes de Bono pMB60 47941...Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro U6 sgRNA BfuAI stuffer 50920 Mammalian/Lentiviral...Zebrafish BseRI none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin...see plasmid page yes, cut S. pyogenes BFP Kuhn pLKO.1-puro U6 sgRNA BfuAI large stuffer 52628 Mammalian/...Puro Zoldos pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110) 71707 Mammalian hU6 yes, cut S. pyogenes Draetta...expression of Cas9, dCas9, or dCas9-VP64 along with 1-4 sgRNAs expressed from independent promoters. sgRNAs...for the expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes...

...M. M., Semenova, E., Severinov, K., De Vos, W. M., Dame, R. T., De Vries, R., Brouns, S. J., & Van Der... most popular genome engineering approach. Figure 1: Overview of the basic CRISPR mechanism Engineered...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex to initiate DNA degradation. Cascade...Cascade C RISPR- as sociated c omplex for a ntiviral de fense; a complex of multiple Cas enzymes including...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...

...Heidenreich 1, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol . 2015 Jan;33(1):102-6...SpCas9 alone without sgRNA. Full references are below. 1. SpCas9 (or SpCas9n, D10A nickase) + single guide ...screens. The libraries are available in two formats: 1 vector system - lentiCRISPR - sgRNA and SpCas9 together..., Scott DA, Mikkelsen TS, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. Science . 2014 Jan 3;343(6166...):186-91. doi: 10.1038/nature14299. Epub 2015 Apr 1. PubMed . Return to AAV In vivo plasmids AAV Plasmids...oligos (design is indicated below) can be cloned into the CRISPR array. The oligos are designed based on...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts Jump to: SpCas9 Plasmids...

...search "lenti". ID Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid...Weinberg 10878 pLKO.1 – TRC cloning plasmid 3rd U6-driven shRNA empty plasmid; includes a stuffer for easy...working with lentivirus: these viruses are based on HIV-1, which may require additional lab biosafety procedures... EGFP coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive or inducible...lentiviral systems available at Addgene have been designed for increased researcher safety. Read our Lentiviral... are used in conjunction with the plasmid that encodes the viral genome (typically called the transfer...

...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense), and four transposase components (TnsA, TnsB...some mammalian systems have been developed. Figure 1: Overview of the basic CAST mechanism. Created with...Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts CRISPR-associated transposases...

...version 1 of the CellTag barcoding library. Version 1 of the Celltag library contains 19973 barcodes to combinatorially...Barcoding Libraries ID Name Description PI 115643 Morris CellTag Barcode Library Version 1 Ready-to-use lentiviral... Guide to Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled...Version 2 of the Celltag library contains 4934 barcodes to combinatorially index cells for single-cell...Version 3 of the Celltag library contains 5737 barcodes to combinatorially index cells for single-cell...

...(Link opens in a new window) References Botman D, de Groot DH, Schmidt P, Goedhart J, Teusink B. In vivo...proteins in budding yeast. Sci Rep. 2019 Feb 19;9(1):2234. doi: 10.1038/s41598-019-38913-z. PubMed 30783202...

...more information on shRNA design and delivery, see resources below. Figure 1: Overview of shRNA-mediated...Publication Additional Resources Addgene Resources pLKO.1 cloning vector protocol Other Addgene viral protocols...target sequence and RISC cleaves and degrades the mRNA. RISC includes argonaute protein 2 (Ago2), which ...RISC). RISC unwinds the double-stranded siRNA and degrades one of the strands. The remaining single-stranded... Trono Lab Lentivectors Toolbox Optimized shRNA design in pSico with pSicoligomaker (Andrea Ventura lab...Taxman, D. J. (2010). Short hairpin RNA (shRNA): design, delivery, and assessment of gene knockdown . Methods...

...Bullock and Port 49411 pCFD4-U6:1_U6:3tandemgRNAs dU6:1 and dU6:3 BbsI Injection or in vitro transcription...O'Connor-Giles, Harrison, Wildonger 49408 pCFD1-dU6:1gRNA dU6:1 BbsI Injection or in vitro transcription Virmilion...Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR plasmids have been designed for use in ... to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template. ID ...CRISPR plasmids that have been designed for use in Drosophila and other insects. CRISPR... can increase transcription of a specific gene. Design your gRNA sequence to direct the dCas9-activator...

...10676 pMKO.1 GFP MoMLV U6-driven plasmid for shRNA expression; also expresses GFP. See pMKO.1 puro for ...envelope and packaging plasmids. ID Plasmid Type Description PI 8449 pUMVC Packaging Contains MoMLV gag and...plasmids that have inserts. ID Plasmid 5'LTR Description PI 1780 pBABE-neo largeTcDNA MoMLV Expression...

...rabies virus (RABV) for monoclonal neuronal tracing. (1) AAV encoding TVA and G-protein is delivered to the...with a deletion-mutant rabies virus. Nat Methods. 4(1):47-9. PMID: 17179932 Wickersham IR, Lyon DC, Barnard...Vectors for Monosynaptic Neuronal Tracing ID Name Description Serotype PI 52473 pAAV-synP-FLEX-splitTVA-EGFP-B19G...

...element Gordon Fishell 83900-AAV1 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV2 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV5 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV8 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV9 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons... Gordon Fishell 83900-AAVrg pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons... Gordon Fishell 83900-PHPeB pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...

...phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas Vector system for expression...immunostaining. Biochem Biophys Res Commun. 2015 Jan 2;456(1):527-33. Gavin Wright pET-30-based vector dedicated...create and express plasmid-based antibodies. Description Article PI One-step assembly of antibody heavy...for "anti-mouse" or "anti-rabbit") ID Plasmid Description Gene/Insert PI Return to top Do you have suggestions...

...Facilitate the Itch-Scratching Cycle via Descending Regulation. Neuron 101(1):45-59. PubMed (Link opens in a new...populations defined by multiple parameters. Figure 1: Examples of intersectional cell population definitions... as a proof-of-concept targeting approach in 2014 1 (using EYFP and ChR2-EYFP as payloads). This approach...interneurons encode fear memory. Nat Neurosci. 23(1):61-74. PubMed (Link opens in a new window) Hafner... experimental design. How-to guide (Link opens in a new window) for the molecular design and testing of...interesting in implementing intersectional experimental design. The Deisseroth Lab maintains a Standard Operating...

...Service at Addgene ID Plasmid Capsid Description PI 112862 pAAV2/1 AAV1 AAV packaging plasmid, expressing...effects in vivo . While AAVs can be handled at BSL-1, AAVs expressing oncogenes or toxins should be handled... are used in conjunction with the plasmid that encodes the viral genome (typically called cis -plasmid...plasmid). Helper Plasmid ID Plasmid Serotype Description PI 112867 pAdDeltaF6 All Helper plasmid for AAV...

... regulate a genome instead of modifying a genome. 1. Two-plasmid CRISPRi system for bacterial gene knockdown...repetitive sequence of human MUC4 exon 3 46915 pU6-sgGAL4-1 Human pSico-based U6 vector containing murine U6 promoter...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts We have recently repurposed...protein and a customized s ingle g uide RNA (sgRNA) designed with a 20-basepair complementary region to any...ampicillin resistance, wherein the N20 can be custom designed to target arbitrary sequences in the genome. Co-expression...sgRNA cassette, wherein the GN19 can be custom designed to target sequences in the genome. The pgRNA_humanized...targeted fluorescent genes. These plasmids are described in: Repurposing CRISPR as an RNA-Guided Platform...

...Bacterial TAG Farren Isaacs 73545 pEvol-pAcFRS.1.t1 pAcFRS.1.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73547 pEvol-pAzFRS.1.t1 pAzFRS.1.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial...7FTrp) Bacterial TAG Thomas Huber 207639 pEVOL-NBK-1 PylRS M. mazei Pyrrolysine Bacterial Cole DeForest...and tyrU gene replaced by GentR) and release factor 1. Expresses archaeal MjTyrRS/tRNA pair instead. For...based upon four nucleotides, 64 codons, and 20 amino acids. Yet in the past two decades, biologists have...included. For any and all questions you have while designing, implementing, or troubleshooting GCE experiments...non-standard amino acid incorporation. ID Strain Description PI 48998 C321.ΔA all TAG sites changes to UAG...

...sequences containing a G nucleotide at position 20 (1 bp upstream of the PAM) may be more efficacious than...population. Some cells may be wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack... in vitro and in vivo. Nature Biotechnology . 33 (1), 73–80. PMID: 25357182...more about how to design your gRNA . Browse Plasmids: gRNAs Synthesize and clone desired gRNAs Once you ...sequences it is time to design your gRNA oligos and clone these oligos into your desired vector. In many cases... Science Guides CRISPR Guide Plan Your Experiment Plan Your CRISPR Experiment Jump To: Plan Your Experiment...Select Genetic Manipulation Select Expression System Design gRNA Publications Get Started CRISPR is a powerful...

...in the iNDI plasmid collection at Addgene. Figure 1: Schematic of iNDI iPSC line generation, phenotyping...types, as noted in the purpose field: ID Plasmid Description Additional Resources iNDI (Link opens in a new...