Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 40 of 645 results
  1. Plasmids for Stem Cell Research

    Type
    Collection
    ... cell reprogramming factors and wait for cells to de-differentiate. However it may be difficult to decide... with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski Lentivirus Human Expression of human...cell reprogramming. Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating...vector. Proc Natl Acad Sci U S A. 2009 Jan 6. 106(1):157-62. Jaenisch Lentivirus Mouse Doxycycline-inducible...transcription factors. Stem Cell Reports. 2015 Jan 13;4(1):25-36. Broccoli Fibroblasts Sensory Neurons Lentiviral...peripheral sensory neurons. Nat Neurosci. 2015 Jan;18(1):25-35. Baldwin Fibroblasts iTSCs Lentiviral Mouse... from Human ALS Patients. Cell Rep. 2016 Jan 5;14(1):115-28. Zhang Adult Dermal Fibroblasts Neurons Lentiviral...
  2. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...foreign DNA and cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview of the endogenous...separated by short palindromic repeat sequences. (1) The CRISPR array is transcribed to make the pre-CRISPR...engineering, with Type V following in 2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain...enChIP) using CRISPR. Biochem Biophys Res Commun . 439(1):132-6. PMID: 23942116 Gilbert LA, Horlbeck MA, Adamson...X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. 2014. Genome-Scale CRISPR-Cas9...CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol . 35(1):31-34. PMID: 27918548...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The CRISPR revolution shows...
  3. Calarco Lab CRISPR Plasmids

    Type
    Collection
    ...has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details....CRISPR Protocols gRNA Design Tools CRISPR Blog Posts A CRISPR/Cas system designed and optimized for work...: [email protected] These plasmids are descirbed in: Heritable genome editing in C. elegans via...
  4. Validated gRNA Sequences

    Type
    Collection
    ...Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes... 60719 activate S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes...
  5. Kamoun Lab CRISPR Plasmids

    Type
    Collection
    ...Kamoun S, Nekrasov V. Plant Methods . 2013 Oct 11;9(1):39. PubMed PMID 24112467 . Individual plasmids can...49771 pICH47742::2x35S-5'UTR-hCas9(STOP)-NOST : Level 1 hCas9 module. 49772 pAGM4723::AtU6p::sgRNA2-2x35S-...CRISPR Protocols gRNA Design Tools CRISPR Blog Posts A CRISPR/Cas system designed and optimized for [email protected] . These plasmids are described in: Targeted mutagenesis in the model plant Nicotiana...in the plant tissue. 46968 pICSL01009::AtU6p : Encodes the Arabidopsis U6 promoter in a level 0 vector...vector for plant gene expression (S. Marillonnet, described in Weber et al. (PLoS One 6:e16765, 2011). 49770...
  6. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm EcoRI none S. pyogenes de Bono pMB60 47941...Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro U6 sgRNA BfuAI stuffer 50920 Mammalian/Lentiviral...Zebrafish BseRI none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin...see plasmid page yes, cut S. pyogenes BFP Kuhn pLKO.1-puro U6 sgRNA BfuAI large stuffer 52628 Mammalian/...Puro Zoldos pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110) 71707 Mammalian hU6 yes, cut S. pyogenes Draetta...expression of Cas9, dCas9, or dCas9-VP64 along with 1-4 sgRNAs expressed from independent promoters. sgRNAs...for the expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes...
  7. Lentivirus Plasmids

    Type
    Collection
    ...search "lenti". ID Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid...Weinberg 10878 pLKO.1 – TRC cloning plasmid 3rd U6-driven shRNA empty plasmid; includes a stuffer for easy...working with lentivirus: these viruses are based on HIV-1, which may require additional lab biosafety procedures... EGFP coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive or inducible...lentiviral systems available at Addgene have been designed for increased researcher safety. Read our Lentiviral... are used in conjunction with the plasmid that encodes the viral genome (typically called the transfer...
  8. Church Lab CRISPR Plasmids

    Type
    Collection
    ...links below: ID Plasmid Description 48669 M-ST1cas Mammalian S. thermophilus #1 Cas9 expression, human ... the 3′ end (see Figure). Mammalian System: Table 1 We provide a collection of reagents for custom CRISPR...transcriptional activator. Streptococcus thermophilus #1 (ST1): Almost as small as NM, ST1 consistently yields...spectinomycin 48647 DS-ST1cas Bacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression, cloDF13/spectinomycin...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts Bacteria and archaea have...can be accessed here . This set of plasmids is described in: RNA-Guided Human Genome Engineering via Cas9...can be ordered via the links below: ID Plasmid Description 41824 gRNA Empty Vector The backbone that a target...
  9. Zhang Lab CRISPR Page

    Type
    Collection
    ...Heidenreich 1, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol . 2015 Jan;33(1):102-6...SpCas9 alone without sgRNA. Full references are below. 1. SpCas9 (or SpCas9n, D10A nickase) + single guide ...screens. The libraries are available in two formats: 1 vector system - lentiCRISPR - sgRNA and SpCas9 together..., Scott DA, Mikkelsen TS, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. Science . 2014 Jan 3;343(6166...):186-91. doi: 10.1038/nature14299. Epub 2015 Apr 1. PubMed . Return to AAV In vivo plasmids AAV Plasmids...oligos (design is indicated below) can be cloned into the CRISPR array. The oligos are designed based on...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts Jump to: SpCas9 Plasmids...
  10. CRISPR Guide

    Type
    Collection
    ... S, De Cian A, Itier JM, Anegon I, Lopez B, Giovannangeli C, Concordet JP. Nat Commun . Mar 19;9(1):1133...Vaimberg EW, Goodale A, Root DE, Piccioni F, Doench JG. Nat Commun . Dec 21;9(1):5416. PMID: 30575746 Synthetic... your experiment. Libraries may be available in a 1-plasmid system, in which Cas9 is included on the gRNA-containing...sequence for Staphylococcus aureus Cas9 (SaCas9) is ∼1 kb shorter than SpCas9, SaCas9 can be efficiently ...sequences containing a G nucleotide at position 20 (1 bp upstream of the PAM) may be more efficacious than...population. Some cells may be wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Jung I, Kim D, Kim S, Kim JS. Nat Commun . Aug 6;9(1):3048. PMID: 30082838 Engineered anti-CRISPR proteins...
  11. Lentiviral Prep Service

    Type
    Collection
    ...version 1 of the CellTag barcoding library. Version 1 of the Celltag library contains 19973 barcodes to combinatorially...Barcoding Libraries ID Name Description PI 115643 Morris CellTag Barcode Library Version 1 Ready-to-use lentiviral... Guide to Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled...Version 2 of the Celltag library contains 4934 barcodes to combinatorially index cells for single-cell...Version 3 of the Celltag library contains 5737 barcodes to combinatorially index cells for single-cell...that are related to COVID-19 research. ID Name Description PI 141391 pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-...
  12. AAV for Neuronal Tracing

    Type
    Collection
    ...rabies virus (RABV) for monoclonal neuronal tracing. (1) AAV encoding TVA and G-protein is delivered to the...with a deletion-mutant rabies virus. Nat Methods. 4(1):47-9. PMID: 17179932 Wickersham IR, Lyon DC, Barnard...Vectors for Monosynaptic Neuronal Tracing ID Name Description Serotype PI 52473 pAAV-synP-FLEX-splitTVA-EGFP-B19G...
  13. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...species = S. pyogenes (PAM = NGG) pCFD1-dU6:1gRNA dU6:1 BbsI Injection or in vitro transcription Virmilion...plasmid Bullock and Port pCFD4-U6:1_U6:3tandemgRNAs dU6:1 and dU6:3 BbsI Injection or in vitro transcription...Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR plasmids have been designed for use in ... to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template. Plasmid...CRISPR plasmids that have been designed for use in Drosophila and other insects. CRISPR... can increase transcription of a specific gene. Design your gRNA sequence to direct the dCas9-activator...
  14. Retrovirus Plasmids

    Type
    Collection
    ...10676 pMKO.1 GFP MoMLV U6-driven plasmid for shRNA expression; also expresses GFP. See pMKO.1 puro for ...envelope and packaging plasmids. ID Plasmid Type Description PI 8449 pUMVC Packaging Contains MoMLV gag and...plasmids that have inserts. ID Plasmid 5'LTR Description PI 1764 pBABE-puro MoMLV For transgene expression...
  15. Brain Initiative Collection

    Type
    Collection
    ...element Gordon Fishell 83900-AAV1 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV2 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV5 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV8 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV9 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons... Gordon Fishell 83900-AAVrg pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons... Gordon Fishell 83900-PHPeB pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...
  16. Antibody Plasmid Collection

    Type
    Collection
    ...phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas Vector system for expression...immunostaining. Biochem Biophys Res Commun. 2015 Jan 2;456(1):527-33. Gavin Wright pET-30-based vector dedicated...create and express plasmid-based antibodies. Description Article PI One-step assembly of antibody heavy...for "anti-mouse" or "anti-rabbit") ID Plasmid Description Gene/Insert PI Return to top Do you have suggestions...
  17. Qi Lab CRISPR Page

    Type
    Collection
    ... regulate a genome instead of modifying a genome. 1. Two-plasmid CRISPRi system for bacterial gene knockdown...repetitive sequence of human MUC4 exon 3 46915 pU6-sgGAL4-1 Human pSico-based U6 vector containing murine U6 promoter...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts We have recently repurposed...protein and a customized s ingle g uide RNA (sgRNA) designed with a 20-basepair complementary region to any...ampicillin resistance, wherein the N20 can be custom designed to target arbitrary sequences in the genome. Co-expression...sgRNA cassette, wherein the GN19 can be custom designed to target sequences in the genome. The pgRNA_humanized...targeted fluorescent genes. These plasmids are described in: Repurposing CRISPR as an RNA-Guided Platform...
  18. Guide RNA Expression Plasmids for EGFP

    Type
    Collection
    ... links below: ID Plasmid 47511 pFYF1320 EGFP Site#1 47512 pFYF1320 EGFP Site#2 47513 pFYF1320 EGFP Site...CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The Joung Lab recently described the use CRISPR-Cas/...
  19. Guide RNA Expression Plasmids for Endogenous Human Genes

    Type
    Collection
    ...the links below: ID Plasmid 47505 pVC297 VEGF Site#1 47506 pVC297 VEGF Site#2 47507 pVC297 VEGF Site#3 ...CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The Joung Lab recently described the use CRISPR-Cas/...
  20. Plasmids for AVEXIS screening

    Type
    Collection
    ...interactions Sun Y et al., Analytical Biochem 2012 May 1;424(1):45-53. PubMed 22342946 Plasmid ID Plasmid Name 32402...start producing proteins for AVEXIS screening. It includes negative control bait and preys (containing the...
Showing: 21 - 40 of 645 results