Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 40 of 597 results
  1. Qi Lab CRISPR Page

    Type
    Collection
    ... cause up to 2~3-fold repress on targeted fluorescent genes. These plasmids are described in: Repurposing...could cause up to 300-fold repress on targeted genes. 2. Two-plasmid CRISPRi system for mammalian gene knockdown...promoter and sgRNA targeting GFP (NT1) 46917 pU6-sgCXCR4-2 Human pSico-based U6 vector containing murine U6 promoter... UAS promoter (negative control) 46918 pU6-sgCD71-2 Human pSico-based U6 vector containing murine U6 promoter...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts We have recently repurposed...protein and a customized s ingle g uide RNA (sgRNA) designed with a 20-basepair complementary region to any...ampicillin resistance, wherein the N20 can be custom designed to target arbitrary sequences in the genome. Co-expression...
  2. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    ...overview of the most common methods. BioBrick BioBrick-2 BglBrick Silver Standard Freiburg Standard BioBrick...visit iGEM: BioBrick (RFC 10) Back to Top BioBrick BB-2 (RFC 12) Prefix: GAATTC GCGGCCGC T ACTAGT G Prefix...XbaI, SapI For more info, visit iGEM: BioBrick BB-2 (RFC 12) Back to Top BglBrick – Berkeley Standard ...after the promoter, and so on. The following table provides information for the assembly standards most commonly...will need to be reverse complimented for primer design. The restriction enzymes used for assembly are ..., NotI , PstI Scar: GCTAGT Features: 6 bp scar encodes Ala-Ser; Allows for in-frame fusions; NheI is rare...Enzymes: BamHI , Xhol Scar: GGATCT Features: Scar encodes Gly-Ser in-frame with prefix start codon; Employs...
  3. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...transcribed to make the pre-CRISPR RNA (pre-crRNA). (2) The pre-crRNA is processed into individual crRNAs...2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type ... with unprecedented speed and specificity. Figure 2: An overview of CRISPR and NHEJ/HDR. The Cas9/gRNA...regulation of transcription in eukaryotes. Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino...X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. 2014. Genome-Scale CRISPR-Cas9...Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell . 163(3):759-71. PMID: 26422227...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The CRISPR revolution shows...
  4. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ...is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity, experimental... with 1. homology to the DNA flanking the DSB and 2. a specific edit close to the gRNA PAM site. When ...Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts Fully functional CRISPR...or search the tables below for CRISPR plasmids designed to introduce a DSB. Plasmids are available for...
  5. TALEN Guide

    Type
    Collection
    ...par with ZF arrays, if not slightly lower. Figure 2: Simplified representation of the Voytas/Bogdanove...variety of backbones in just a few steps ( Figure 2 ). The Bogdanove group also hosts web-based software...mammalian transcription. Nat Biotechnol. 2011 Feb;29(2):149-53. PMID: 21248753 . TALEs for the masses. Rusk...components of the array recognize individual nucleotides. For over ten years, zinc finger (ZF) arrays ...that came out in the spring of 2011, the groups describe a set of customized plasmids that can be used ... a TALEN kit through Addgene. This kit, first described in Nature Biotechnology in August, uses a serial...in Nature Biotechnology early in 2011 and they described their kit for assembling TAL effector arrays in...
  6. Neurodegeneration Research Collection

    Type
    Collection
    ...different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals develop...study aggregation. Saha et al. Nat Commun. 2023 Feb 2. Study the C terminal domain of TDP-43 to better understand... rodent species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 ...with the iPSC toolbox . Lam et al. bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression...brain. The cause of this neuron death is unknown. Despite the idiopathic (having no specific known cause)...scientific community at low cost, with rapid delivery. Includes antibodies, viral vectors, animal models, purified...
  7. Validated gRNA Sequences

    Type
    Collection
    ...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below lists gRNA...the particular conditions of the experiment as described in the associated article (listed below by PubMed...
  8. CRISPR Guide

    Type
    Collection
    ...is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity, experimental...Sequences Glossary Publications CRISPR Overview Class 2 C lustered R egularly I nterspaced S hort P alindromic...systems enable researchers to target anywhere from 2 to 7 genetic loci by cloning multiple gRNAs into a... is included on the gRNA-containing plasmid, or a 2-plasmid system in which Cas9 must be delivered separately...library (panel E ). Remember - if you are using a 2-vector system, you will need to transduce cells that...either (1) a lack of gRNA and/or Cas9 expression or (2) a lack of efficient target cleavage in cells expressing...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ...
  9. Adenovirus Plasmids

    Type
    Collection
    ...recombining shuttle plasmids Vogelstein 16401 pAdEasy-2 Adenoviral For recombining shuttle plasmids; for use with...transgene under CMV promoter Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle Test plasmid that contains β-...strains for generating adenovirus. ID Strain Description PI 16398 BJ5183 Strain for recombination between... plasmids that have inserts. ID Plasmid Type Description PI 16400 pAdEasy-1 Adenoviral For recombining... be assembled in a one-tube reaction. ID Kit Description PI 1000000176 AdenoBuilder toolkit Plasmids contain...
  10. Viral Production

    Type
    Collection
    ...suggests that titers obtained using ddPCR are generally 2–3 fold higher than those achieved using the standard...catalog item (see maps section for images). Figure 2: AAV Pro cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre... a new vial of early passage cells. Approximately 2 weeks post-thaw, cell culture supernatant is tested...protocols, titering methods, and quality control are described below. AAV Production AAV distributed by Addgene...
  11. Antibody Plasmid Collection

    Type
    Collection
    ...phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas Vector system for expression...+J phagemid libraries. Immunol Lett. 2015 Oct;167(2):95-102. Joanna Bereta Sybody Generation Toolbox for...create and express plasmid-based antibodies. Description Article PI One-step assembly of antibody heavy...for "anti-mouse" or "anti-rabbit") ID Plasmid Description Gene/Insert PI Return to top Do you have suggestions...
  12. Golden Gate Assembly Upgrades: More Fragments, Faster Assembly, and Higher Fidelity

    Type
    Blog Post
    ...outgrowth volumes described in Figure 3, with calculated yields from entire outgrowth built from 2 µl of the ...Golden Gate Assembly is commonly used to assemble 2–10 DNA fragments in a single “one-pot” reaction to...the transformants onto the selection plate. Figure 2 shows representative transformation plates obtained...fidelity studies conducted by Potapov et al. at NEB (1, 2). While T4 DNA Ligase, the mainstay of most biotechnological... (percent correct) Calculated colony totals Per 2 μl assembly reaction Per full assembly reaction** ...fidelity and bias profiling." bioRxiv (2018): 322297. 2. Potapov, Vladimir, et al. "A single-molecule sequencing... push the test system, we redesigned for 12 and 24 fragments.  This redesign was guided by both advances...
  13. Huang Lab CRISPR Plasmids

    Type
    Collection
    ...Z, Zhang X, Zhang P, Huang X. Cell Res . 2013 Apr 2. PubMed PMID 23545779 . PMC3641603 . Individual plasmids...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts A human codon-optimized...embryos and mouse embryos. These plasmids are described in: Generation of gene-modified mice via Cas9/...codon-optimized Cas9 expression plasmid, specifically designed for efficient nuclear localization in eukaryotes...
  14. Guide RNA Expression Plasmids for EGFP

    Type
    Collection
    ...47511 pFYF1320 EGFP Site#1 47512 pFYF1320 EGFP Site#2 47513 pFYF1320 EGFP Site#3...CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The Joung Lab recently described the use CRISPR-Cas/...
  15. Antibodies 101: Designing Your First Flow Panel

    Type
    Blog Post
    ... first panel! Designing a Panel In this example, I will describe a basic panel (Table 2) for a hypothetical.... To understand why that is, let's look at Figure 2. The blue laser excites at a wavelength of 488 nm ... of PE's excitation spectrum (dotted line, Figure 2). The yellow/green laser, however, excites at 561nm...relatively stronger—or brighter—signal.   Figure 2: Excitation and emission spectra for PE. The excitation... (eGFP expression).     The first stain in Table 2 is a standard and should always be included—the live...from the other fluorophores to avoid bleeding and 2) BV421 is a very bright fluorophore, which makes it...case the CD45 expression turns out to be weak. Table 2: A simple staining panel to detect live, transduced...
  16. Guide RNA Expression Plasmids for Endogenous Human Genes

    Type
    Collection
    ...Plasmid 47505 pVC297 VEGF Site#1 47506 pVC297 VEGF Site#2 47507 pVC297 VEGF Site#3 47508 pFYF1548 EMX1 47509...CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The Joung Lab recently described the use CRISPR-Cas/...
  17. Antibody Neutralization Response Against Pseudoviruses Expressing SARS-CoV-2 Spike Protein Variants

    Type
    Blog Post
    ... Moosa M-YS, Lessells RJ, de Oliveira T, Sigal A (2021) Escape of SARS-CoV-2 501Y.V2 from neutralization...months, we’ve seen the emergence of several SARS-CoV-2 variants coincide with increased vaccination efforts...They were able to tweak this assay to study SARS-CoV-2 spike variants. “We created a series of spike expressing...relative ability to neutralize.”   Figure 2: Sera used in the study came from individuals who ...This sera was used in the high-throughput SARS-CoV-2 pseudovirus neutralization assay. Neutralization was...viruses are quite genetically distinct from SARS-CoV-2 and its variants. Yet, the B.1.351 variant, which ...effectiveness of current vaccines against SARS-CoV-2 variants, this study was the first to compare so many...
  18. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity, experimental...Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts To make targeted epigenetic...catalytically dead dCas9 to epigenetic modifiers. Design your gRNA to target a specific promoter or enhancer...
  19. CRISPR Plasmids - Repress Gene Expression

    Type
    Collection
    ...is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity, experimental...Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts Catalytically dead dCas9...gene expression by interfering with transcription. Design your gRNA to target your gene of interest’s promoter...
Showing: 21 - 40 of 597 results