Skip to main content
Addgene
Showing: 21 - 40 of 607 results
  1. Pouring LB Agar Plates

    Type
    Protocol
    ... you are working with any weird and wonderful organisms. While your samples are sterilizing in the autoclave...
  2. CRISPR Library Amplification

    Type
    Protocol
    ...DNA: guide RNAs targeting different genes in an organism's genome, for example. Amplification is usually...
  3. Immunology Research Plasmids and Resources

    Type
    Collection
    ...chemokine ligand 14, chemokine ligand 15 transcription unit - CCL15 chemokine (C-C motif) ligand 15 HCC-...chemokine (C-C motif) ligand 1 I-309, P500, SCYA1, SISe, TCA3 CCL11 chemokine (C-C motif) ligand 11 MGC22554, ...motif) ligand 19 CKb11, ELC, MGC34433, MIP-3b, MIP3B, SCYA19 CCL2 chemokine (C-C motif) ligand 2 GDCF-...C-C motif) ligand 20 CKb4, LARC, MIP-3a, MIP3A, SCYA20, ST38 CCL21 chemokine (C-C motif) ligand 21 6Ckine...chemokine (C-C motif) ligand 24 Ckb-6, MPIF-2, MPIF2, SCYA24 CCL25 chemokine (C-C motif) ligand 25 Ckb15, MGC150327...motif) ligand 27 ALP, CTACK, CTAK, ESKINE, ILC, PESKY, SCYA27 CCL28 chemokine (C-C motif) ligand 28 CCK1...
  4. Worm Expression Resources

    Type
    Collection
    ...Caenorhabditis elegans ( C. elegans or “the worm”) is widely used as a genetic model organism due to their...genome editing in C. elegans via a CRISPR-Cas9 system. Cloning-free CRISPR for C. elegans , which uses purified...Tools Fire Lab C. elegans Vector Kit - Andrew Fire Lab. A set of vectors for C. elegans research, including...plasmids for use in C. elegans . Return to top Other Resources Addgene Blog Posts An “elegans” Approach to Better...Genes with SapTrap Even more elegant: Single injection CRISPR/Cas9 in C. elegans External Resources Caenorhabditis...stocks of C. elegans. Silencing Genomes - Cold Spring Harbor's guide to RNAi in C. elegans WormAtlas - ...engineer the genome of the genetic model organism C. elegans. Return to top Do you have suggestions for...
  5. Validated gRNA Sequences

    Type
    Collection
    ...avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...dpy-10 C. elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...
  6. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Zebrafish/Xenopus/C.elegans/Sea urchin pCS2+8NCerulean - Zebrafish/Xenopus/C.elegans/Sea urchin mCerulean...- Zebrafish/Xenopus/C.elegans/Sea urchin pCS2+8NeGFP - Zebrafish/Xenopus/C.elegans/Sea urchin pKT0128 ...Zebrafish/Xenopus/C.elegans/Sea urchin pCS2+8NmCitrine - Zebrafish/Xenopus/C.elegans/Sea urchin pET mCitrine...Zebrafish/Xenopus/C.elegans/Sea urchin pCS2+8NmOrange - Zebrafish/Xenopus/C.elegans/Sea urchin mOrange-N1...Zebrafish/Xenopus/C.elegans/Sea urchin pCS2+8NmCherry - Zebrafish/Xenopus/C.elegans/Sea urchin pET mCherry... Fluorescent Protein Fusions (Organized by Expression Species) Organism/Expression System Plasmids Mammalian...C-terminal GFP for C. elegans expression pHT101-mCherry - N- or C-terminal mCherry for C. elegans expression Yeast...
  7. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Scaffold for inorganic phosphate biosensor Development of a Reagentless Biosensor for Inorganic Phosphate...receptor ligands (GABA-Snifit) A fluorescent sensor for GABA and synthetic GABA(B) receptor ligands. J Am...biosensors can be introduced into cells, tissues, or organisms for long-term imaging and can be designed to specifically...specifically localize to cellular compartments or organelles. Addgene’s database includes many fluorescent.... in vivo , cytoplasmic vs. extracellular vs. organelle-localized). Browse or search the tables below ...and In Vivo Imaging of Ca Dynamics in High-Ca Organelles. Cell Chem Biol. 2016 Jun 1. pii: S2451-9456(...sensors (green, red or blue/green) Imaging intraorganellar Ca(2+) at subcellular resolution using CEPIA...
  8. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... structures give the cell its shape, organize cellular organelles, and are necessary for movement and ...RAB7 GFP Richard Pagano 12661 DsRed-rab7 WT Late endosomes RAB7 DsRed Richard Pagano 158006 pCMV-mGold-Lysosome-N... GFP Richard Pagano 12679 DsRed-rab11 WT Recycling endosomes Rab11a DsRed Richard Pagano *Fusions to other... Plasmid Collections Fluorescent Proteins Organelle Markers Fluorescent Proteins: Subcellular Localization... fusion proteins that are targeted to various organelles or subcellular structures. You should fuse your...General Structures The cell contains a variety of organelles and subcellular structures each with their own...table below to find markers of general cellular organelles and structures. ID Plasmid Structure Targeting...
  9. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...L4440 - RNAi in C. elegans Transgenic Expression in organisms pBigT - For making ...promoter that will be functional in your host organism. Host Relevant Promoters Representative Empty ...Worm unc-54, variety of worm gene promoters C. elegans vector kit - Collection of plasmids... Andrew Fire L4440 - RNAi in C. elegans Dupuy Lab and Lehner Lab vectors - Tools for nematode... pDM#834 - C-terminal GST for C elegans expression GFP Localization pcDNA3-EGFP - C-terminal...pPD95_75 - C-terminal GFP for C elegans expression Other Fluorescent Proteins Localization...Selectable Marker Typical Host Organism Representative Empty Backbones Neomycin...
  10. CRISPR References and Information

    Type
    Collection
    ...supports: Drosophila, Arabidopsis, zebrafish, C. elegans, mouse, human, rat, cow, dog, pig, Thale cress,...subtilis ), yeast ( S. cerevisiae ), worm ( C. elegans ), fruit fly, zebrafish, mouse, rat, and human....HDR. Reference genomes include Arabidopsis, C. elegans , sea squirt, cavefish, Chinese hamster, fruit ...target site common to a set of similar sequences. Organisms include human, mouse, rat, chicken, frog, zebrafish...laevis), zebrafish, sea squirt, Drosophila, C. elegans, Arabidopsis, rice, sorghum, silkworm, and budding...supports: Drosophila, Arabidopsis, zebrafish, C. elegans, mouse, human, rat, rabbit, pig, possum, chicken...supports: Drosophila, Arabidopsis, zebrafish, C. elegans , mouse, human, rat, yeast, frog, Brachypodium ...
  11. Zebrafish Plasmid Collection

    Type
    Collection
    ...been established as a powerful vertebrate model organism for the study of genetics and developmental biology...Multicolor fluorescent labeling in zebrafish Whole organism lineage tracing by combinatorial and cumulative...screening fluorescent protein fusion expression in organisms or cells in which an exogenous mRNA can be injected...assembly for the zebrafish genome. Zebrafish Model Organism Database (ZFIN) - A curated database of genetic... International Zebrafish Society (IZFS) - An organization that promotes and advocates for zebrafish research...aims to increase the use of zebrafish as a model organism and to foster advanced training of young scientists...
  12. Institute for Protein Innovation

    Type
    Collection
    ...subunit, outside the ligand-binding pocket Bind to the beta subunit, outside the ligand-binding pocket Bind...pairs, outside the ligand-binding pocket Bind specific subunit pairs, blocking ligand binding and receptor...animal immunization. IPI is a nonprofit research organization with a mission to advance protein science to...
  13. Cre-lox system

    Type
    Collection
    ...constructs require the addition of an exogenous ligand (e.g. tamoxifen) to activate Cre. One advantage...Green 12494 p260 pCMV-CRE-M-AR(wt) CREM fused to AR ligand binding domain CMV Mammalian Green 12496 p270 pCMV-CRE-M-AR... pCMV-CRE-M-AR(LNCaP) CREM fused to mutant AR ligand binding domain CMV Mammalian Green 12497 p274 pCMV-CRE-M-AR...pCMV-CRE-M-AR(T) CREM fused to mutant AR ligand binding domain CMV Mammalian Green 12529 pBS MCK CRE Muscle-specific... Ekker 47551 pDD104 (Peft-3::Cre) Cre eft-3 C. elegans Goldstein 48201 CAG-GFP-IRES-CRE Cre and GFP coexpression...Cre CMV RABV Jessell 73717 pMLS328 Cre eft-3 C. elegans Jorgensen 75267 pAAV-CIBN-CreC photo-activatable...Mammalian Okano 153207 pAM-AAV-mSncg-Cre Retinal ganglion cell-specific expression of Cre Mouse Sncg AAV...
  14. Plan Your Experiment

    Type
    Collection
    ...these principles apply to using CRISPR in other organisms. First, consider the genetic manipulation that...carry out your experiment in your particular model organism. There may not be a perfect plasmid for your specific...disrupt gene function in a particular cell type or organism without a specific preferred mutation Cas9 (or...sequence and design your gRNA. Know your cell line/organism and genomic sequence When possible, you should...may vary depending on the specific cell line or organism, which may affect the observed efficiency of CRISPR...
  15. Plasmids for Stem Cell Research

    Type
    Collection
    ...Fibroblasts. Cell Stem Cell. 2019 Jun 6. Buganim Glial Cells Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron...and have the capacity to give rise to an entire organism. iPSC technology removes the possible ethical ...neurons. Cell Stem Cell. 2011 Sep 2;9(3):205-18. Eggan Fibroblasts Neural Precursor Cells Lentiviral Mouse...Cells. Cell Stem Cell. 2015 Nov 5;17(5):543-56. Buganim Skin Fibroblasts Motor Neurons Lentiviral Human...
  16. Microbiology Resources

    Type
    Collection
    ...these model organisms. See below for plasmid kits and other resources relevant to these organisms, or use ...depositors are making this possible in a range of organisms. Find CRISPR tools for use in genome editing of...extensive fluorescent protein plasmid collection is organized by application and by color. External Resources...
  17. CRISPR Plasmids - Tagging

    Type
    Collection
    ...Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR...targeting vectors to insert genetic tags in the C. elegans genome. The SapTrap reaction produces a single ... tagging in Drosophila cells 3.3 MB Seydoux C. elegans Tagging System Geraldine Seydoux's lab has developed..., insertions, and deletions at any locus in C. elegans . This system uses a 10-day protocol, generates...
  18. CRISPR Plasmids - Activate Gene Expression

    Type
    Collection
    ...upregulating gene expression in various model organisms....Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR...Insert Promoter Selectable Marker PI Publication C. elegans ID Plasmid Gene/Insert Promoter PI Publication ...
  19. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ...Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR...mammalian systems, bacteria, Drosophila, plants, C. elegans, yeast, zebrafish, and Xenopus. Mammalian ID Plasmid...Insert Promoter Selectable Marker PI Publication C. elegans ID Plasmid Gene/Insert Promoter Selectable Marker...
  20. CRISPR Plasmids and Resources

    Type
    Collection
    ...variety of organisms, including mammals, plants, bacteria, yeast, Drosophila, zebrafish, C. elegans, parasites... on our popular CRISPR 101 blog series, we've organized a comprehensive CRISPR resource for you to download...
Showing: 21 - 40 of 607 results