Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 388 results for: nans

Showing: 21 - 40 of 388 results

  1. Antibody Plasmid Collection

    Type
    Collection
    ...Verdoes Backbones for mouse recombinant antibodies A panel of recombinant monoclonal antibodies against..., including monoclonal antibodies, scFvs, and nanobodies. Plasmid... Collection Addgene distributes ready-to-use recombinant antibodies made from plasmids in our collection...alternative approach is to use synthetically produced recombinant antibodies, created by cloning antibody components...Some scientists choose to work with full length recombinant monoclonal antibodies (R-mAbs) expressed in mammalian...research applications from the NeuroMab/Trimmer Lab Recombinant mAb Collection . Once the plasmids are transiently...of production due to their small size. These recombinant antibody fragments can be used in experiments...

  2. Antibody Guide

    Type
    Collection
    ...Antibodies produced this way are called recombinant antibodies. Recombinant antibodies are created by cloning... time and labor intensive. Recombinant expression validation A recombinant expression strategy is used...cultured immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals... of a single antibody with little variation. Recombinant plasmids - Antibodies can be produced from plasmids...abundant isotype in blood, also found in tissues; predominant isotype in secondary immune response Monomer ...Single-domain antibodies (sdAbs), also called nanobodies, are ~12-15 kD single heavy domain fragments ...Diabodies can be used for assembling protein nanostructures. Figure 2: An antibody (IgG, far left) compared...

  3. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Flp AND Vcre No References Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu...Hafner G, Witte M, Guy J, Subhashini N, Fenno LE, Ramakrishnan C, Kim YS, Deisseroth K, Callaway EM, Oberhuber...Poulin JF, Caronia G, Hofer C, Cui Q, Helm B, Ramakrishnan C, Chan CS, Dombeck DA, Deisseroth K, Awatramani...Limoges A, Brockway E, Müller K, Fenno L, Kim YS, Ramakrishnan C, Andrási T, Deisseroth K, Holmes A, Hájos ...new window) Yu K, Ahrens S, Zhang X, Schiff H, Ramakrishnan C, Fenno L, Deisseroth K, Zhao F, Luo MH, Gong... M, Johansson Y, Fuzik J, Fürth D, Fenno LE, Ramakrishnan C, Silberberg G, Deisseroth K, Carlén M, Meletis...Burnham N, Cristiano C, Dorrier CE, Tipton GJ, Ramakrishnan C, Kozicz T, Deisseroth K, Thiele TE, McElligott...

  4. Institute for Protein Innovation

    Type
    Collection
    ...Find unique recombinant antibodies targeting families of cell surface and secreted proteins from a collaboration...Innovation (IPI) Collection! Here, you’ll find unique recombinant antibodies targeting families of cell surface...courtesy of IPI Browse Glypican Antibodies ID Recombinant Antibody Description Isotype Reactivity Recommended...courtesy of IPI Browse Integrin Antibodies ID Recombinant Antibody Description Isotype Reactivity Recommended...Browse Epitope Tag Antibodies IPI has developed recombinant versions of antibodies that recognize common ... tags and other common cellular proteins. ID Recombinant Antibody Description Isotype Reactivity Recommended...

  5. Validated gRNA Sequences

    Type
    Collection
    ...25619936 Sato NANOG H. sapiens TGGCATATTCCTGATTTAAAAGT 64156 activate S. pyogenes 25619936 Sato NANOG H. sapiens...25619936 Sato NANOG H. sapiens TGGGCCTTGGTGAGACTGGTAGA 64154 activate S. pyogenes 25619936 Sato NANOG H. sapiens...25619936 Sato NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...

  6. Antibody Production

    Type
    Collection
    ...methods and quality control processes for purified recombinant antibodies....webpage for further information. Production For recombinant antibodies (rAb) encoded by mammalian expression...initially titered by spectrophotometry using a NanoDrop spectrophotometer. If needed, the sample is adjusted...performed in parallel with a previous lot of recombinant antibody or the hybridoma-derived equivalent ... Residual Plasmid Sanger Sequencing Purified recombinant antibody preps contain low levels of co-purified...

  7. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Temperature Imaging with a Genetically Encoded Nanothermometer. Nano Lett. 2022 Jul 27;22(14):5698-5707. Takeharu...permuted fluorescent protein (cpFP) or fluorescence resonance energy transfer (FRET) efficiency of a pair of...):e35373. Susan Amara , Susan Ingram Citrate Nanosensors for in vivo measurements of citrate (CitA) Engineering...Engineering genetically encoded nanosensors for real-time in vivo measurements of citrate concentrations... levels and metabolism (FLIPmal) Fluorescence Resonance Energy Transfer sensors for quantitative monitoring...Visualize intracellular tryptophan levels and flux Nanosensor detection of an immunoregulatory tryptophan influx...-pHluorin Clathrin-mediated endocytosis is the dominant mechanism of vesicle retrieval at hippocampal ...

  8. Neurodegeneration Research Collection

    Type
    Collection
    ...anti-kinesin recombinant scFvs . Niwa et al. Cytoskeleton. 2023 Apr 10. Explore the recombinant monoclonal...familial cases, usually inherited in an autosomal dominant manner, are associated with known genetic mutations...Huntington’s disease (HD) is a fatal autosomal dominant genetic disorder that causes the progressive degeneration..., including monoclonal antibodies, scFvs, and nanobodies. New and Noteworthy: Browse our growing collection...

  9. COVID-19 Resources

    Type
    Collection
    ... found on this page: SARS-CoV-2 Antibodies : Recombinant monoclonal antibodies that target SARS-CoV-2 ... Nucleocapsid Protein [mBG17] - Clone mBG17, recombinant mouse monoclonal antibody targeting the SARS-... Nucleocapsid Protein [mBG86] - Clone mBG86, recombinant mouse monoclonal antibody targeting the SARS-...available from Andrea Pauli's lab. Neutralizing nanobodies bind SARS-CoV-2 spike RBD and block interaction...Jul 13. (Link opens in a new window) SARS-CoV-2 Nanobodies now available from Ray Owens' lab. Development...

  10. Bacterial Expression Systems

    Type
    Collection
    ... to enhance protein solubility and to direct recombinant proteins to the periplasmic space between the...Timers Return to top Protein Interactions Förster resonance energy transfer (FRET) and bimolecular fluorescence...Escherichia coli , Mycobacterium tuberculosis Vinay Nandicoori 78577 pL99 PnitA-NitR ε-caprolactam Escherichia...Escherichia coli , Mycobacterium tuberculosis Vinay Nandicoori 188974 pREDusk-AmpR-MCS FixK2 Red light (660 ...Addgene Blog Luciferase Technologies Enabled by NanoLuc® Luciferase Fluorescent Biosensors Chromoproteins...

  11. Tags and Other Markers

    Type
    Collection
    ...Find recombinant antibodies targeting epitope tags and common fusion proteins....common cellular proteins. These ready-to-use recombinant monoclonal antibodies undergo application-specific...and their use, visit our Antibody Guide . ID Recombinant Antibody Description Source Species Isotype Reactivity...

  12. Neuroscience

    Type
    Collection
    ...Find recombinant antibodies targeting neuroscience-related proteins....in neuroscience research. These ready-to-use recombinant monoclonal antibodies undergo application-specific...and their use, visit our Antibody Guide . ID Recombinant Antibody Description Source Species Isotype Reactivity...

  13. Plasmids for Stem Cell Research

    Type
    Collection
    ...Otonkoski Lentivirus Human Expression of human Sox2, Nanog, Oct4, and Lin28 from four separate lentiviral plasmids...polycistronic expression of human Oct4, Klf4, Sox2, c-Myc, Nanog, Lin28, NR5A2, and microRNA 302/367 in three different... gene-specific plasmids at the following links: NANOG , OCT4 , SOX2 , MYC , KLF4 , LIN28 . Differentiation...Methods. 2015 Nov 25. pii: S1046-2023(15)30159-6. Brennand iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN...

  14. Antibodies

    Type
    Collection
    ...Overview of Addgene's ready-to-use monoclonal recombinant antibody collection. These affinity reagents ... Antibodies Addgene distributes ready-to-use recombinant antibodies to help facilitate scientific research...affinity reagent plasmids - including antibodies, nanobodies, scFvs, and more! Find Plasmids...

  15. All Antibodies

    Type
    Collection
    ...Browse Addgene's collection of recombinant monoclonal antibodies....Antibodies Addgene distributes ready-to-use recombinant antibodies. These monoclonal antibodies undergo application-specific...Antibody Suggestion Form . Browse All Antibodies ID Recombinant Antibody Description Source Species Isotype Reactivity...

  16. Distribution to Industry

    Type
    Collection
    ...Ordering and MTA Information Featured Collections NEW NanoLuc and HaloTag Fusions from Promega COVID-19 SARS-... Antibodies Addgene distributes ready-to-use recombinant antibodies made from plasmids in our collection...as by our trusted partner labs. Learn More ID Recombinant Antibody Reactivity Recommended Applications ...

  17. Brain Initiative Collection

    Type
    Collection
    ... Antibodies Addgene distributes ready-to-use recombinant antibodies made from plasmids in our collection...partner labs. Learn more about our antibodies ID Recombinant Antibody Reactivity Recommended Applications ...Initiative Resource List . NeuroMab/Trimmer Lab Recombinant mAb Plasmid Collection . The NeuroMab Facility...

  18. Depositor Collections

    Type
    Collection
    ...Pooled Libraries Antibodies NeuroMab/Trimmer Lab Recombinant mAb Plasmid Collection Disease Research Michael... Simpson Reagents for improved expression of recombinant phosphoproteins - Rinehart FreeGenes Project ...

  19. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...) are small viruses originally discovered as contaminants of adenovirus stocks. One major advantage of...low immune response and low toxicity. Although recombinant AAV does not integrate into the host genome, ...

  20. p53 Pathway

    Type
    Collection
    ...to activate transcription, and they also have a dominant negative effect on functional p53 through oligomerization...Uncovering the role of p53 splice variants in human malignancy: a clinical perspective. Surget S, Khoury MP,...
Showing: 21 - 40 of 388 results