Skip to main content
Addgene
Showing: 21 - 40 of 382 results

  1. Antibody Guide

    Type
    Collection
    ...Antibodies produced this way are called recombinant antibodies. Recombinant antibodies are created by cloning... time and labor intensive. Recombinant expression validation A recombinant expression strategy is used...cultured immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals... of a single antibody with little variation. Recombinant plasmids - Antibodies can be produced from plasmids...abundant isotype in blood, also found in tissues; predominant isotype in secondary immune response Monomer ...Single-domain antibodies (sdAbs), also called nanobodies, are ~12-15 kD single heavy domain fragments ...Diabodies can be used for assembling protein nanostructures. Figure 2: An antibody (IgG, far left) compared...

  2. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Flp AND Vcre No References Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu...Hafner G, Witte M, Guy J, Subhashini N, Fenno LE, Ramakrishnan C, Kim YS, Deisseroth K, Callaway EM, Oberhuber...Poulin JF, Caronia G, Hofer C, Cui Q, Helm B, Ramakrishnan C, Chan CS, Dombeck DA, Deisseroth K, Awatramani...Limoges A, Brockway E, Müller K, Fenno L, Kim YS, Ramakrishnan C, Andrási T, Deisseroth K, Holmes A, Hájos ...new window) Yu K, Ahrens S, Zhang X, Schiff H, Ramakrishnan C, Fenno L, Deisseroth K, Zhao F, Luo MH, Gong... M, Johansson Y, Fuzik J, Fürth D, Fenno LE, Ramakrishnan C, Silberberg G, Deisseroth K, Carlén M, Meletis...Burnham N, Cristiano C, Dorrier CE, Tipton GJ, Ramakrishnan C, Kozicz T, Deisseroth K, Thiele TE, McElligott...

  3. Institute for Protein Innovation

    Type
    Collection
    ...Find unique recombinant antibodies targeting families of cell surface and secreted proteins from a collaboration...Innovation (IPI) Collection! Here, you’ll find unique recombinant antibodies targeting families of cell surface...courtesy of IPI Browse Glypican Antibodies ID Recombinant Antibody Description Isotype Reactivity Recommended...courtesy of IPI Browse Integrin Antibodies ID Recombinant Antibody Description Isotype Reactivity Recommended...Browse Epitope Tag Antibodies IPI has developed recombinant versions of antibodies that recognize common ... tags and other common cellular proteins. ID Recombinant Antibody Description Isotype Reactivity Recommended...

  4. Validated gRNA Sequences

    Type
    Collection
    ...25619936 Sato NANOG H. sapiens TGGCATATTCCTGATTTAAAAGT 64156 activate S. pyogenes 25619936 Sato NANOG H. sapiens...25619936 Sato NANOG H. sapiens TGGGCCTTGGTGAGACTGGTAGA 64154 activate S. pyogenes 25619936 Sato NANOG H. sapiens...25619936 Sato NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...

  5. Antibody Production

    Type
    Collection
    ...methods and quality control processes for purified recombinant antibodies....webpage for further information. Production For recombinant antibodies (rAb) encoded by mammalian expression...initially titered by spectrophotometry using a NanoDrop spectrophotometer. If needed, the sample is adjusted...performed in parallel with a previous lot of recombinant antibody or the hybridoma-derived equivalent ... Residual Plasmid Sanger Sequencing Purified recombinant antibody preps contain low levels of co-purified...

  6. Bacterial Expression Systems

    Type
    Collection
    ... pGRG Series Various Plasmids Tn7 Transposition Nancy Craig A gene of interest cloned into one of these...lactose/IPTG inducible vector for expression of a recombinant protein with an N-terminal 6x His tag and an ...IPTG inducible vector for high expression of a recombinant protein with a 6x His tag. Requires a strain ...formation. Proteins of interest are fused to AraC or a dominant negative AraC. Preferential association of AraC-fusion...araBAD promoter whereas heterodimer formation with dominant negative AraC decreases GFP expression. Zinc Finger...

  7. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Temperature Imaging with a Genetically Encoded Nanothermometer. Nano Lett. 2022 Jul 27;22(14):5698-5707. Takeharu...permuted fluorescent protein (cpFP) or Förster resonance energy transfer (FRET) efficiency of a pair of...):e35373. Susan Amara , Susan Ingram Citrate Nanosensors for in vivo measurements of citrate (CitA) Engineering...Engineering genetically encoded nanosensors for real-time in vivo measurements of citrate concentrations... levels and metabolism (FLIPmal) Fluorescence Resonance Energy Transfer sensors for quantitative monitoring...Visualize intracellular tryptophan levels and flux Nanosensor detection of an immunoregulatory tryptophan influx...-pHluorin Clathrin-mediated endocytosis is the dominant mechanism of vesicle retrieval at hippocampal ...

  8. Neurodegeneration Research Collection

    Type
    Collection
    ...anti-kinesin recombinant scFvs . Niwa et al. Cytoskeleton. 2023 Apr 10. Explore the recombinant monoclonal...familial cases, usually inherited in an autosomal dominant manner, are associated with known genetic mutations...Huntington’s disease (HD) is a fatal autosomal dominant genetic disorder that causes the progressive degeneration..., including monoclonal antibodies, scFvs, and nanobodies. New and Noteworthy: Browse our growing collection...

  9. COVID-19 Resources

    Type
    Collection
    ... found on this page: SARS-CoV-2 Antibodies : Recombinant monoclonal antibodies that target SARS-CoV-2 ... Nucleocapsid Protein [mBG17] - Clone mBG17, recombinant mouse monoclonal antibody targeting the SARS-... Nucleocapsid Protein [mBG86] - Clone mBG86, recombinant mouse monoclonal antibody targeting the SARS-...available from Andrea Pauli's lab. Neutralizing nanobodies bind SARS-CoV-2 spike RBD and block interaction...Jul 13. (Link opens in a new window) SARS-CoV-2 Nanobodies now available from Ray Owens' lab. Development...

  10. Tags and Other Markers

    Type
    Collection
    ...Find recombinant antibodies targeting epitope tags and common fusion proteins....common cellular proteins. These ready-to-use recombinant monoclonal antibodies undergo application-specific...and their use, visit our Antibody Guide . ID Recombinant Antibody Description Source Species Isotype Reactivity...

  11. Neuroscience

    Type
    Collection
    ...Find recombinant antibodies targeting neuroscience-related proteins....in neuroscience research. These ready-to-use recombinant monoclonal antibodies undergo application-specific...and their use, visit our Antibody Guide . ID Recombinant Antibody Description Source Species Isotype Reactivity...

  12. Antibodies

    Type
    Collection
    ...Overview of Addgene's ready-to-use monoclonal recombinant antibody collection. These affinity reagents ... Antibodies Addgene distributes ready-to-use recombinant antibodies to help facilitate scientific research...affinity reagent plasmids - including antibodies, nanobodies, scFvs, and more! Find Plasmids...

  13. Plasmids for Stem Cell Research

    Type
    Collection
    ...Otonkoski Lentivirus Human Expression of human Sox2, Nanog, Oct4, and Lin28 from four separate lentiviral plasmids...polycistronic expression of human Oct4, Klf4, Sox2, c-Myc, Nanog, Lin28, NR5A2, and microRNA 302/367 in three different... gene-specific plasmids at the following links: NANOG , OCT4 , SOX2 , MYC , KLF4 , LIN28 . Differentiation...Methods. 2015 Nov 25. pii: S1046-2023(15)30159-6. Brennand iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN...

  14. All Antibodies

    Type
    Collection
    ...Browse Addgene's collection of recombinant monoclonal antibodies....Addgene distributes ready-to-use recombinant antibodies. These monoclonal antibodies undergo application-...Antibody Suggestion Form . Browse All Antibodies ID Recombinant Antibody Description Source Species Isotype Reactivity...

  15. Cre-lox system

    Type
    Collection
    ...Youle 59720 Nanog-CreER targeting construct Cre-ERT2; Targeting vector for Nanog locus mNanog Mammalian ...fused to HIV-TAT - promotes cellular uptake of recombinant Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc...

  16. Depositor Collections

    Type
    Collection
    ...Pooled Libraries Antibodies NeuroMab/Trimmer Lab Recombinant mAb Plasmid Collection CRISPR CRISPR-on: an RNA-guided... Simpson Reagents for improved expression of recombinant phosphoproteins - Rinehart FreeGenes Project ...

  17. Brain Initiative Collection

    Type
    Collection
    ... Antibodies Addgene distributes ready-to-use recombinant antibodies made from plasmids in our collection...partner labs. Learn more about our antibodies ID Recombinant Antibody Reactivity Recommended Applications ...Initiative Resource List . NeuroMab/Trimmer Lab Recombinant mAb Plasmid Collection . The NeuroMab Facility...

  18. EXtracellular Plasmid RESource (EXPRESs) Consortium

    Type
    Collection
    ...surface receptor and secreted proteins as soluble recombinant molecules....surface receptor and secreted proteins as soluble recombinant molecules. The proteins are typically used in...

  19. Distribution to Industry

    Type
    Collection
    ... Antibodies Addgene distributes ready-to-use recombinant antibodies made from plasmids in our collection...as by our trusted partner labs. Learn More ID Recombinant Antibody Reactivity Recommended Applications ...

  20. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...) are small viruses originally discovered as contaminants of adenovirus stocks. One major advantage of...low immune response and low toxicity. Although recombinant AAV does not integrate into the host genome, ...
Showing: 21 - 40 of 382 results