...cloned, expressed and validated in recombinant form. The recombinant monoclonal antibodies or R-mAbs have... recombinant monoclonal antibody. Cav1.2 Mouse Mouse IgG2a 225372 SynDIG2 (Mus musculus) recombinant monoclonal...Mouse Mouse Nanobody Plasmid Collection The following plasmids can be used to produce nanobodies from transfected... anti-Homer1 nanobody HS63 Homer1 Mouse Llama 134716 HS69 pComb3xss anti-Homer1 nanobody HS69 Homer1 Mouse... anti-Homer1 nanobody HS89 Homer1 Mouse Llama 134718 HC25 pComb3xss anti-Homer1 nanobody HC25 Homer1 Mouse... anti-Homer1 nanobody HC89 Homer1 Mouse Llama 134720 GC1 pComb3xss anti-Gephyrin nanobody GC1 Gephyrin...anti-Gephyrin nanobody GC83 Gephyrin Mouse Llama 135219 HS22 pEYFPN1 anti-Homer1 nanobody HS22 Homer1 Mouse...

...Ferrer 87067 pcDNA3.1-ccdB-Nanoluc NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Taipale 87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning... Taipale 87078 pLenti6.2-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Oskar Laur 87070 pcDNA3.1-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...luciferase Liqun Luo 51970 Nano-lantern/pcDNA3 Nano-lantern CMV Mammalian expression of Nano-lantern Takeharu Nagai...Technologies Enabled by NanoLuc® Luciferase Blog: Luminescent Imaging with Nano-lanterns Collection Highlights...interactions. NanoLuc® complementation : Protein-protein assays based on a split NanoLuc® have been used...

...Verdoes Backbones for mouse recombinant antibodies A panel of recombinant monoclonal antibodies against..., including monoclonal antibodies, scFvs, and nanobodies. Plasmid... Collection Addgene distributes ready-to-use recombinant antibodies made from plasmids in our collection...alternative approach is to use synthetically produced recombinant antibodies, created by cloning antibody components...Some scientists choose to work with full length recombinant monoclonal antibodies (R-mAbs) expressed in mammalian...research applications from the NeuroMab/Trimmer Lab Recombinant mAb Collection . Once the plasmids are transiently...of production due to their small size. These recombinant antibody fragments can be used in experiments...

...Antibodies produced this way are called recombinant antibodies. Recombinant antibodies are created by cloning... time and labor intensive. Recombinant expression validation A recombinant expression strategy is used...cultured immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals... of a single antibody with little variation. Recombinant plasmids - Antibodies can be produced from plasmids...abundant isotype in blood, also found in tissues; predominant isotype in secondary immune response Monomer ...Single-domain antibodies (sdAbs), also called nanobodies, are ~12-15 kD single heavy domain fragments ...Diabodies can be used for assembling protein nanostructures. Figure 2: An antibody (IgG, far left) compared...

...Flp AND Vcre No References Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu...Hafner G, Witte M, Guy J, Subhashini N, Fenno LE, Ramakrishnan C, Kim YS, Deisseroth K, Callaway EM, Oberhuber...Poulin JF, Caronia G, Hofer C, Cui Q, Helm B, Ramakrishnan C, Chan CS, Dombeck DA, Deisseroth K, Awatramani...Limoges A, Brockway E, Müller K, Fenno L, Kim YS, Ramakrishnan C, Andrási T, Deisseroth K, Holmes A, Hájos ...new window) Yu K, Ahrens S, Zhang X, Schiff H, Ramakrishnan C, Fenno L, Deisseroth K, Zhao F, Luo MH, Gong... M, Johansson Y, Fuzik J, Fürth D, Fenno LE, Ramakrishnan C, Silberberg G, Deisseroth K, Carlén M, Meletis...Burnham N, Cristiano C, Dorrier CE, Tipton GJ, Ramakrishnan C, Kozicz T, Deisseroth K, Thiele TE, McElligott...

...Find unique recombinant antibodies targeting families of cell surface and secreted proteins from a collaboration...Innovation (IPI) Collection! Here, you’ll find unique recombinant antibodies targeting families of cell surface...courtesy of IPI Browse Glypican Antibodies ID Recombinant Antibody Description Isotype Reactivity Recommended...courtesy of IPI Browse Integrin Antibodies ID Recombinant Antibody Description Isotype Reactivity Recommended...Browse Epitope Tag Antibodies IPI has developed recombinant versions of antibodies that recognize common ... tags and other common cellular proteins. ID Recombinant Antibody Description Isotype Reactivity Recommended...

...25619936 Sato NANOG H. sapiens TGGCATATTCCTGATTTAAAAGT 64156 activate S. pyogenes 25619936 Sato NANOG H. sapiens...25619936 Sato NANOG H. sapiens TGGGCCTTGGTGAGACTGGTAGA 64154 activate S. pyogenes 25619936 Sato NANOG H. sapiens...25619936 Sato NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...

...methods and quality control processes for purified recombinant antibodies....webpage for further information. Production For recombinant antibodies (rAb) encoded by mammalian expression...initially titered by spectrophotometry using a NanoDrop spectrophotometer. If needed, the sample is adjusted...performed in parallel with a previous lot of recombinant antibody or the hybridoma-derived equivalent ... Residual Plasmid Sanger Sequencing Purified recombinant antibody preps contain low levels of co-purified...

... pGRG Series Various Plasmids Tn7 Transposition Nancy Craig A gene of interest cloned into one of these...lactose/IPTG inducible vector for expression of a recombinant protein with an N-terminal 6x His tag and an ...IPTG inducible vector for high expression of a recombinant protein with a 6x His tag. Requires a strain ...formation. Proteins of interest are fused to AraC or a dominant negative AraC. Preferential association of AraC-fusion...araBAD promoter whereas heterodimer formation with dominant negative AraC decreases GFP expression. Zinc Finger...

...Temperature Imaging with a Genetically Encoded Nanothermometer. Nano Lett. 2022 Jul 27;22(14):5698-5707. Takeharu...permuted fluorescent protein (cpFP) or Förster resonance energy transfer (FRET) efficiency of a pair of...):e35373. Susan Amara , Susan Ingram Citrate Nanosensors for in vivo measurements of citrate (CitA) Engineering...Engineering genetically encoded nanosensors for real-time in vivo measurements of citrate concentrations... levels and metabolism (FLIPmal) Fluorescence Resonance Energy Transfer sensors for quantitative monitoring...Visualize intracellular tryptophan levels and flux Nanosensor detection of an immunoregulatory tryptophan influx...-pHluorin Clathrin-mediated endocytosis is the dominant mechanism of vesicle retrieval at hippocampal ...

...anti-kinesin recombinant scFvs . Niwa et al. Cytoskeleton. 2023 Apr 10. Explore the recombinant monoclonal...familial cases, usually inherited in an autosomal dominant manner, are associated with known genetic mutations...Huntington’s disease (HD) is a fatal autosomal dominant genetic disorder that causes the progressive degeneration..., including monoclonal antibodies, scFvs, and nanobodies. New and Noteworthy: Browse our growing collection...

... found on this page: SARS-CoV-2 Antibodies : Recombinant monoclonal antibodies that target SARS-CoV-2 ... Nucleocapsid Protein [mBG17] - Clone mBG17, recombinant mouse monoclonal antibody targeting the SARS-... Nucleocapsid Protein [mBG86] - Clone mBG86, recombinant mouse monoclonal antibody targeting the SARS-...available from Andrea Pauli's lab. Neutralizing nanobodies bind SARS-CoV-2 spike RBD and block interaction...Jul 13. (Link opens in a new window) SARS-CoV-2 Nanobodies now available from Ray Owens' lab. Development...

...Find recombinant antibodies targeting epitope tags and common fusion proteins....common cellular proteins. These ready-to-use recombinant monoclonal antibodies undergo application-specific...and their use, visit our Antibody Guide . ID Recombinant Antibody Description Source Species Isotype Reactivity...

...Find recombinant antibodies targeting neuroscience-related proteins....in neuroscience research. These ready-to-use recombinant monoclonal antibodies undergo application-specific...and their use, visit our Antibody Guide . ID Recombinant Antibody Description Source Species Isotype Reactivity...

...Overview of Addgene's ready-to-use monoclonal recombinant antibody collection. These affinity reagents ... Antibodies Addgene distributes ready-to-use recombinant antibodies to help facilitate scientific research...affinity reagent plasmids - including antibodies, nanobodies, scFvs, and more! Find Plasmids...

...Otonkoski Lentivirus Human Expression of human Sox2, Nanog, Oct4, and Lin28 from four separate lentiviral plasmids...polycistronic expression of human Oct4, Klf4, Sox2, c-Myc, Nanog, Lin28, NR5A2, and microRNA 302/367 in three different... gene-specific plasmids at the following links: NANOG , OCT4 , SOX2 , MYC , KLF4 , LIN28 . Differentiation...Methods. 2015 Nov 25. pii: S1046-2023(15)30159-6. Brennand iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN...

...Browse Addgene's collection of recombinant monoclonal antibodies....Addgene distributes ready-to-use recombinant antibodies. These monoclonal antibodies undergo application-...Antibody Suggestion Form . Browse All Antibodies ID Recombinant Antibody Description Source Species Isotype Reactivity...

...Youle 59720 Nanog-CreER targeting construct Cre-ERT2; Targeting vector for Nanog locus mNanog Mammalian ...fused to HIV-TAT - promotes cellular uptake of recombinant Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc...

...Pooled Libraries Antibodies NeuroMab/Trimmer Lab Recombinant mAb Plasmid Collection CRISPR CRISPR-on: an RNA-guided... Simpson Reagents for improved expression of recombinant phosphoproteins - Rinehart FreeGenes Project ...

... Antibodies Addgene distributes ready-to-use recombinant antibodies made from plasmids in our collection...partner labs. Learn more about our antibodies ID Recombinant Antibody Reactivity Recommended Applications ...Initiative Resource List . NeuroMab/Trimmer Lab Recombinant mAb Plasmid Collection . The NeuroMab Facility...