We narrowed to 396 results for: promoter
-
TypeGuide...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG... AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse... shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward...cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10 promoter Forward Gal4...
-
Molecular Biology Reference
TypeGuide...downstream from a promoter to drive expression of the inserted gene. Insert The gene, promoter, or other DNA...particular plasmid. Promoter Region Drives transcription of the insert. The promoter recruits transcriptional...strength of the promoter can control the level of insert expression, as a strong promoter directs high expression...weaker promoters can direct low/endogenous expression levels. For more information about promoters, check...resources, including: Molecular Cloning Techniques Promoters Sequencing Primers Origins of Molecular Genetics... for a variety of studies used to investigate promoters, small RNAs, and other genetic elements. Plasmid...check out our promoters reference page . Selectable Marker Used to select for cells that have successfully... -
Lentiviral Vector Guide
TypeGuide...LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially deleted and fused...with a heterologous promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins...plasmids include tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat...contains a chimeric 5’ LTR fused to a heterologous promoter (often CMV or RSV), eliminating the need for transactivation... fused to a heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope... mitigated through the use of tissue-specific promoters and envelope genes, and/or with site-specific ... -
Gamma-Retroviral Vector Guide
TypeGuide...heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript... to prefer transcription start sites, such as promoters and enhancers. Many times, integration sites are...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope...selection is driven by strong enhancers and active promoters. Nucleic Acids Research , 42 (7), 4257–4269. https...plasmids use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription... -
Modular Cloning Guide
TypeGuide...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc.) flanked... a single transcriptional unit (for example, a promoter, a 5' UTR, a signal peptide, a protein-coding ...Paul Freemont 78 plasmids including constitutive promoters, T7 expression, RBS strength variants, synthetic...cross-compatible plasmids including 11 inducible promoters, 16 RBS strength variants, 8 tag-compatible RBSs... nucleases, base editors, gRNA backbones, and promoters for genome editing in monocots and dicots. pDGE... -
Plan Your Experiment
TypeGuide...template Cas9 or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency...prime editing. CRISPR Intereference : Target the promoter region of the gene of interest, where the Cas9...approaches, the species and expression pattern of the promoter for both your Cas enzyme and gRNA and the presence...the wide range of options for the Cas enzyme, promoters, and selection markers. There are also no packaging...to specific cell types by using cell-specific promoters, which is useful for in vivo studies. While we...transfect, transduce, or may not express common promoters. Browse Cas9 plasmids for RNP delivery . As mentioned... -
Chemogenetics Guide
TypeGuide...Chemogenetic Plasmids ! Table 4. Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor... -
CRISPR Guide
TypeGuide...are often used to change an amino acid, turn a promoter on/off, or add small protein tags. Precise Modifications... editors include several fused components that promote the intended repair pathway or inhibit unwanted... converting cytidine to uridine. However, they promote the base excision repair pathway, which fully removes...improved PE2/PE3 to inhibit mismatch repair to promote desired edit epegRNA — addition of a structured...while activation and repression libraries target promoter or enhancer regions. As each library is unique...transcriptional repressors or activators and targeting promoter regions. You might sometimes see these referred...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation... -
Addgene's eBook Collection
TypeGuide... from parts, nomenclature, and uses to common promoters and cloning techniques! Close About Overlay Select... -
Adeno-associated virus (AAV) Guide
TypeGuide... proteins, often under strong neuron-specific promoters or neural Cre-dependent expression, to visualize...recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis...nuclear export of RNA and RNA translation, and promotes RNA transcript longevity. Located between WPRE... -
Trimmer Lab NeuroMab Collection
TypeCollection... and heavy (blue) chains as driven by two CMV promoters (orange). Hybridoma-derived V L and V H domain...light chain polyA tail sequences (κ pA), a CMV promoter for heavy chain expression, and an ER signal/leader...the p1316 plasmid that contains an upstream CMV promoter for light chain expression, and an ER signal/leader... -
Adenovirus Guide
TypeGuide... Repeat, serve as self-priming structures that promote primase-independent DNA replication. 3' ITR (RITR... Repeat, serve as self-priming structures that promote primase-independent DNA replication. Homology arms... -
Molecular Cloning Techniques
TypeGuide...and Gateway destination vectors with different promoters, tags, selection markers, and fluorescent proteins... -
Optogenetics Guide
TypeGuide...expression of the opsin. Depending on the virus and promoter system used, there is an incubation time (days... -
Neurodegeneration Plasmid Collection
TypeCollection...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...basic-hFX-promotor(1kb) FXN hFXN Friedreich ataxia Michael Ristow 14979 pGL3-basic-hFX-promotor(1,3kb) FXN...basic-hFX-promotor(2,5kb) FXN hFXN Friedreich ataxia Michael Ristow 14981 pGL3-basic-hFX-promotor(2kb, distal...pGL3Basic_ME.1/ApoEpromoter APOE ApoE Alzheimer's Sohail Tavazoie 51436 pGL3Basic-ME.2/ApoEpromoter APOE ApoE... -
Immunology Research Plasmids and Resources
TypeCollection... MCH2, MCH2R, SLT MDK midkine (neurite growth-promoting factor 2) FLJ27379, MK, NEGF2 MET met proto-oncogene... different fluorescent proteins, 10 mammalian promoters and enhancers, 3 polyA signals as well as selection...