We narrowed to 430 results for: %s

...Ravin, S. S., Su, L., Theobald, N., Choi, U., Macpherson, J. L., Poidinger, M., Symonds, G., Pond, S. M.,..., Abreu, S., Rubat, L., Nikoniuk, A., Macmorland, W., Horlock, C., Matsumoto, S., Williams, S., Smith,...Viral Protocols References Coffin, J. M., Hughes, S. H., & Varmus, H. E. (Eds.). (1997). Principles of...., Ferris, A. L., Hughes, S. H., Malech, H. L., & Wu, X. (2014). Enhancers are major targets for murine...., Wolfsberg, T. G., Baxevanis, A. D., & Burgess, S. M. (2014). MLV integration site selection is driven...Smith, K., Price, J., Srivastava, S., Hussain, R., Banani, M. A., Day, W., Stevenson, E., Madigan, M., Chen...doi.org/10.3390/v13081471 PMID: 34452336 Schnierle, B. S., Stitz, J., Bosch, V., Nocken, F., Merget-Millitzer...

... Kim, H. S., Hwang, G., Lee, H. K., Bae, T., Park, S., Kim, Y. J., Lee, S., Park, J., Bae, S., & Hur, ..., J. N., Norberg, S. M., Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek...36348415 Stewart, S. A., Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S., Sabatini, D. ...30518911 Wells, D. W., Guo, S., Shao, W., Bale, M. J., Coffin, J. M., Hughes, S. H., & Wu, X. (2020). An ...10.1128/jvi.72.11.8463-8471.1998 PMID: 9765382 Durand, S., & Cimarelli, A. (2011). The inside out of lentiviral...., Edavettal, J. M., Swaminathan, T. A., & Braun, S. E. (2021). HIV-based lentiviral vectors: Origin and...Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert, B. L., Root, D. E., Doench, J....

...AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter... of GFP Reverse GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG...synthase promoter Forward Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter Forward OpIE2 Forward CGCAACGATCTGGTAAACAC... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG ...

...designed your gRNA(s), the next step is to choose how to express your Cas enzyme and gRNA(s) in your target...., Adamson, B., Norman, T. M., Lander, E. S., Weissman, J. S., Friedman, N., & Regev, A. (2016). Perturb-Seq...Ploegh, H. L., Bassik, M. C., Qi, L. S., Kampmann, M., & Weissman, J. S. (2014). Genome-Scale CRISPR-Mediated...References CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system that...generally only compatible with smaller Cas enzymes, like S. aureus Cas9. For more information, see our blog post...

..., C., Gorbatyuk, O. S., Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel...B. Y., Viswanathan, S., Gaj, T., Lavzin, M., Ritola, K. D., Lindo, S., Michael, S., Kuleshova, E., Ojala...tropism of AAV serotypes, indicating different serotype(s) for transduction of a given organ. Tissue Serotype...W. L., Sánchez-Guardado, L., Lois, C., Mazmanian, S. K., Deverman, B. E., & Gradinaru, V. (2017). Engineered...12871018 (Link opens in a new window) Hüser, D., Weger, S., & Heilbronn, R. (2003). Packaging of human chromosome...

...plasmid. Additionally, the restriction enzyme site(s) allow for the cloning of a DNA fragment of interest...experiment. Plasmid Type Description Addgene Resource(s) Cloning Plasmids Used to facilitate the cloning of...information and a more extensive strain list. Strain Vendor(s) Genotype BL21 Invitrogen; New England BioLabs E. ...datasheet or the plasmid map to confirm which antibiotic(s) to add to your LB media or LB agar plates. For more..., or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino Acids ..., UUC Proline Pro P CCU, CCC, CCA, CCG Serine Ser S UCU, UCC, UCA, UCG, AGU,AGC Threonine Thr T ACU, ACC...SV40 NLS PKKKRKV or PKKKRKVG Protein C EDQVDPRLIDGK S Tag KETAAAKFERQHMDS SB1 PRPSNKRLQQ Additional Resources...

...variety of N- and C-terminal tags (including His, S-tag, OneStrep, CBP, Trx, GST, Halo, MBP, NusA and ...

...CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which ...

...cathepsin L1 CATL, CTSL, FLJ31037, MEP CTSS cathepsin S MGC3886 ERAP1 endoplasmic reticulum aminopeptidase..., CLAP, c-E10, mE10 BLNK B-cell linker BASH, BLNK-S, LY57, MGC111051, SLP-65, SLP65 BTK Bruton agammaglobulinemia... Culture External Resouces Immport : Bhattacharya S, Dunn P, Thomas CG, Smith B, Schaefer H, Chen J, Hu...

...slotted in a specific direction based on the emission(s) read by the machine. Controls for cell sorting methods...