Skip to main content

We narrowed to 441 results for: %s

Showing: 421 - 440 of 441 results
  1. CRISPR Guide

    Type
    Guide
    ...23287722 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou,...Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T., Abudayyeh, O. O., Gootenberg, J. S., Mori, H...Chandrasekaran, S. S., Perry, N. T., Schaepe, J., Du, P. P., Lotfy, P., Bassik, M. C., Bintu, L., Bhatt, A. S., & ...PMID: 38216671 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S., & Sternberg, S. H. (2019). Transposon-encoded...Scheiman, J., Vora, S., Pruitt, B. W., Tuttle, M., Iyer, E. P. R., Lin, S., Kiani, S., Guzman, C. D., Wiegand..., E. C., Newberry, K. M., Smith, S. B., Meadows, S. K., Roberts, B. S., Mackiewicz, M., Mendenhall, E....Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung...
  2. Chemogenetics Guide

    Type
    Guide
    ...Nonneman, R. J., Huang, X. P., Hufeisen, S. J., Guettier, J. M., Moy, S. S., Wess, J., Caron, M. G., Calakos,...: 38450294 Coward, P., Wada, H. G., Falk, M. S., Chan, S. D., Meng, F., Akil, H., & Conklin, B. R. (1998...Snowball, A., Knauss, S., von Schimmelmann, M., During, M. J., Lignani, G., Schorge, S., Young, D., Kullmann...their activity in neurons PSAM Ion Pore Domain Ligand(s) Effect Outcome (in neurons) Reference PSAM4 Gly Varenicline...References and Further Reading Atasoy, D., & Sternson, S. M. (2018). Chemogenetic Tools for Causal Cellular...Armbruster, B.N., Li, X., Pausch, M.H., Herlitze, S., Roth, B.L. (2007). Evolving the lock to fit the ...Berglund, K., Clissold, K., Li, H. E., Wen, L., Park, S. Y., Gleixner, J., Klein, M. E., Lu, D., Barter, J...
  3. Modular Cloning Guide

    Type
    Guide
    ...Laboratory Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. A modular cloning system for standardized... Gruetzner R, Ehnert TM, Werner S, Jones JD, Patron NJ, Marillonnet S. A golden gate modular cloning toolbox...vectors specific for tobacco ( N. tabacum ) or potato ( S. tuberosum ). Joint Modular Cloning (JMC) Toolkit ... assembly of single and multi-gene constructs for S. cerevisiae expression. Multiplex Yeast Toolkit (MYT...the MoClo-YTK (Dueber) for genetic engineering of S. cerevisiae , enabling larger multi-gene constructs...transcription units for protein secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). ... plasmids for genome integration in fission yeast S. pombe . These can be used with plasmids from the ...
  4. Optogenetics Guide

    Type
    Guide
    ...Y., Kim, S. S., Pulver, S. R., Birdsey-Benson, A., Cho, Y. K., Morimoto, T. K., Chuong, A. S., Carpenter..., Henninger, M. A., Kodandaramaiah, S. B., Ogawa, M., Ramanlal, S. B., Bandler, R. C., Allen, B. D., Forest...in a new window) , Karl Deisseroth Lab Boyden, E. S., Zhang, F., Bamberg, E., Nagel, G., & Deisseroth,.../doi.org/10.1038/nn1525 PMID: 16116447 Chuong, A. S., Miri, M. L., Busskamp, V., Matthews, G. A., Acker... X., Lin, Y., Tye, K. M., Roska, B., … Boyden, E. S. (2014). Noninvasive optical inhibition with a red-shifted....2010.02.037 PMID: 20303157 Han, X., & Boyden, E. S. (2007). Multiple-color optical activation, silencing... Constantine-Paton, M., Wong, G. K., … Boyden, E. S. (2014). Independent optical excitation of distinct...
  5. Adenovirus Guide

    Type
    Guide
    ...Adenoviral Vector topics References Ahi, Y. S., Bangari, D. S., & Mittal, S. K. (2011). Adenoviral vector immunity...) Ewer, K. J., Sebastian, S., Spencer, A. J., Gilbert, S. C., Hill, A. V. S., & Lambe, T. (2017). Chimpanzee... new window) Lee, C. S., Bishop, E. S., Zhang, R., Yu, X., Farina, E. M., Yan, S., Zhao, C., Zheng, Z....J., Stanley, D., Honko, A., Johnson, J., Mulangu, S., Pau, M. G., Custers, J., Vellinga, J., Hendriks,...PMID: 21325402 (Link opens in a new window) Gilbert, S. C. (2015). Adenovirus-vectored Ebola vaccines . Expert...26289977 (Link opens in a new window) He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., & Vogelstein... Li, Y., Zhang, W., Yang, C., Wu, K., Wu, Y., Ho, S., Athiviraham, A., Lee, M. J., Wolf, J. M., Reid, ...
  6. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Ravin, S. S., Su, L., Theobald, N., Choi, U., Macpherson, J. L., Poidinger, M., Symonds, G., Pond, S. M.,..., Abreu, S., Rubat, L., Nikoniuk, A., Macmorland, W., Horlock, C., Matsumoto, S., Williams, S., Smith,...Viral Protocols References Coffin, J. M., Hughes, S. H., & Varmus, H. E. (Eds.). (1997). Principles of...., Ferris, A. L., Hughes, S. H., Malech, H. L., & Wu, X. (2014). Enhancers are major targets for murine...., Wolfsberg, T. G., Baxevanis, A. D., & Burgess, S. M. (2014). MLV integration site selection is driven...Smith, K., Price, J., Srivastava, S., Hussain, R., Banani, M. A., Day, W., Stevenson, E., Madigan, M., Chen...doi.org/10.3390/v13081471 PMID: 34452336 Schnierle, B. S., Stitz, J., Bosch, V., Nocken, F., Merget-Millitzer...
  7. Lentiviral Vector Guide

    Type
    Guide
    ... Kim, H. S., Hwang, G., Lee, H. K., Bae, T., Park, S., Kim, Y. J., Lee, S., Park, J., Bae, S., & Hur, ..., J. N., Norberg, S. M., Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek...36348415 Stewart, S. A., Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S., Sabatini, D. ...30518911 Wells, D. W., Guo, S., Shao, W., Bale, M. J., Coffin, J. M., Hughes, S. H., & Wu, X. (2020). An ...10.1128/jvi.72.11.8463-8471.1998 PMID: 9765382 Durand, S., & Cimarelli, A. (2011). The inside out of lentiviral...., Edavettal, J. M., Swaminathan, T. A., & Braun, S. E. (2021). HIV-based lentiviral vectors: Origin and...Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert, B. L., Root, D. E., Doench, J....
  8. Sequencing Primers

    Type
    Guide
    ...AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter... of GFP Reverse GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG...synthase promoter Forward Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter Forward OpIE2 Forward CGCAACGATCTGGTAAACAC... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG ...
  9. Plan Your Experiment

    Type
    Guide
    ...designed your gRNA(s), the next step is to choose how to express your Cas enzyme and gRNA(s) in your target...., Adamson, B., Norman, T. M., Lander, E. S., Weissman, J. S., Friedman, N., & Regev, A. (2016). Perturb-Seq...Ploegh, H. L., Bassik, M. C., Qi, L. S., Kampmann, M., & Weissman, J. S. (2014). Genome-Scale CRISPR-Mediated...References CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system that...generally only compatible with smaller Cas enzymes, like S. aureus Cas9. For more information, see our blog post...
  10. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ..., C., Gorbatyuk, O. S., Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel...B. Y., Viswanathan, S., Gaj, T., Lavzin, M., Ritola, K. D., Lindo, S., Michael, S., Kuleshova, E., Ojala...tropism of AAV serotypes, indicating different serotype(s) for transduction of a given organ. Tissue Serotype...W. L., Sánchez-Guardado, L., Lois, C., Mazmanian, S. K., Deverman, B. E., & Gradinaru, V. (2017). Engineered...12871018 (Link opens in a new window) Hüser, D., Weger, S., & Heilbronn, R. (2003). Packaging of human chromosome...
  11. Antibody Guide

    Type
    Collection
    ...slotted in a specific direction based on the emission(s) read by the machine. Controls for cell sorting methods...
  12. Molecular Biology Reference

    Type
    Guide
    ...plasmid. Additionally, the restriction enzyme site(s) allow for the cloning of a DNA fragment of interest...experiment. Plasmid Type Description Addgene Resource(s) Cloning Plasmids Used to facilitate the cloning of...information and a more extensive strain list. Strain Vendor(s) Genotype BL21 Invitrogen; New England BioLabs E. ...datasheet or the plasmid map to confirm which antibiotic(s) to add to your LB media or LB agar plates. For more..., or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino Acids ..., UUC Proline Pro P CCU, CCC, CCA, CCG Serine Ser S UCU, UCC, UCA, UCG, AGU,AGC Threonine Thr T ACU, ACC...SV40 NLS PKKKRKV or PKKKRKVG Protein C EDQVDPRLIDGK S Tag KETAAAKFERQHMDS SB1 PRPSNKRLQQ Additional Resources...
  13. Science Guides

    Type
    Guide
    ...CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which ...
  14. Immunology Research Plasmids and Resources

    Type
    Collection
    ...cathepsin L1 CATL, CTSL, FLJ31037, MEP CTSS cathepsin S MGC3886 ERAP1 endoplasmic reticulum aminopeptidase..., CLAP, c-E10, mE10 BLNK B-cell linker BASH, BLNK-S, LY57, MGC111051, SLP-65, SLP65 BTK Bruton agammaglobulinemia... Culture External Resouces Immport : Bhattacharya S, Dunn P, Thomas CG, Smith B, Schaefer H, Chen J, Hu...
Showing: 421 - 440 of 441 results