Skip to main content
Addgene

We narrowed to 436 results for: ERG

Showing: 421 - 436 of 436 results
  1. Deep Dive: qPCR

    Type
    Blog Post
    ...and experimental parameters (neighbor stacking energies, loop entropy effects, cation concentrations and...
  2. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...mcb.18.1.93  Ran, F. A., Hsu, P. D., Lin, C., Gootenberg, J. S., Konermann, S., Trevino, A. E., Scott,...
  3. CRISPR Guide

    Type
    Guide
    ...cleavage. Generating a Knockout Using CRISPR Cas9 undergoes a second conformational change upon target binding...stability PEmax - optimized PE architecture; increased synergy between PE enzymes and epegRNAs for enhanced editing... ssisted T argeting), developed by Samuel H. Sternberg’s lab . Many of these systems are based on naturally...argeting E lements), developed by the Abudayyeh - Gootenberg lab , also builds off prime editing. PASTE uses...Welch, M. M., Sousa, A. A., Harrington, L. B., Sternberg, S. H., Joung, J. K., Yildiz, A., & Doudna, J.... S., Okazaki, S., Noda, T., Abudayyeh, O. O., Gootenberg, J. S., Mori, H., Oura, S., Holmes, B., Tanaka...Ran, F. A., Cong, L., Yan, W. X., Scott, D. A., Gootenberg, J. S., Kriz, A. J., Zetsche, B., Shalem, O.,...
  4. Sequencing Primers

    Type
    Guide
    ... forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LucNrev...virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE ... forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors...vectors, reverse primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE ...
  5. Chemogenetics Guide

    Type
    Guide
    ...intracellular region of a turkey erythrocyte β-adrenergic receptor with a rat M3 muscarinic receptor. This... al., 2007 rM3D Rat M3 muscarinic & turkey β1-adrenergic G αs CNO* Increase cAMP Neuronal burst firing...VChR1 CTZ Na + , K + influx Neuronal activation Berglund et al., 2016 LMO7 mNeonGreen-eKL9h VChR1 CFz Na...68. PMID: 17360345 (Link opens in a new window) Berglund K, Clissold K, Li HE, Wen L, Park SY, Gleixner...Liggett SB (2001). Modification of the beta 2-adrenergic receptor to engineer a receptor-effector complex...
  6. Optogenetics Guide

    Type
    Guide
    ...thus expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated...Optogenetics Resource Center Boyden ES, Zhang F, Bamberg E, Nagel G, Deisseroth K. 2005. Millisecond-timescale...
  7. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...LaFave, M. C., Varshney, G. K., Gildea, D. E., Wolfsberg, T. G., Baxevanis, A. D., & Burgess, S. M. (2014...Schnierle, B. S., Stitz, J., Bosch, V., Nocken, F., Merget-Millitzer, H., Engelstädter, M., Kurth, R., Groner...
  8. Lentiviral Vector Guide

    Type
    Guide
    ... Pelayo, A., Shah, N. N., Kochenderfer, J. N., Norberg, S. M., Hinrichs, C., Highfill, S. L., Somerville...D. M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...
  9. Modular Cloning Guide

    Type
    Guide
    ... in filamentous fungi such as Penicillium or Aspergillus species. MoClo Yeast Secretion and Display (YSD...
  10. Molecular Biology Reference

    Type
    Guide
    ...i.e., smaller) DNA fragments. In 1952, Joshua Lederberg coined the term plasmid, in reference to any extrachromosomal...
  11. Antibody Guide

    Type
    Guide
    ...against parasites and is responsible for driving allergic reactions such as anaphylactic shock Monomer with...
Showing: 421 - 436 of 436 results