We narrowed to 435 results for: erg
-
TypeBlog Post...elimination by T cells. Immunotherapy strategies that synergize with these positive impacts on the immune system...
-
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...liver and ameliorates streptozotocin-induced hyperglycemia. Nat Med, 2000. 6(5): p. 568-72. PubMed PMID... -
How to Deposit Your Plasmids with Addgene
TypeBlog Post...notify you that we have received them and they will undergo our quality control process to verify your plasmids... -
Deep Dive: qPCR
TypeBlog Post...and experimental parameters (neighbor stacking energies, loop entropy effects, cation concentrations and... -
CRISPR/Cas9 FAQs Answered!
TypeBlog Post...mcb.18.1.93 Ran, F. A., Hsu, P. D., Lin, C., Gootenberg, J. S., Konermann, S., Trevino, A. E., Scott,... -
Technical Design of a Western Blot
TypeBlog Post... most Bradford assays are not compatible with detergents like SDS, while BCA assays are not with denaturing... -
CRISPR Guide
TypeGuide...cleavage. Generating a Knockout Using CRISPR Cas9 undergoes a second conformational change upon target binding...stability PEmax - optimized PE architecture; increased synergy between PE enzymes and epegRNAs for enhanced editing... ssisted T argeting), developed by Samuel H. Sternberg’s lab . Many of these systems are based on naturally...argeting E lements), developed by the Abudayyeh - Gootenberg lab , also builds off prime editing. PASTE uses...Welch, M. M., Sousa, A. A., Harrington, L. B., Sternberg, S. H., Joung, J. K., Yildiz, A., & Doudna, J.... S., Okazaki, S., Noda, T., Abudayyeh, O. O., Gootenberg, J. S., Mori, H., Oura, S., Holmes, B., Tanaka...Ran, F. A., Cong, L., Yan, W. X., Scott, D. A., Gootenberg, J. S., Kriz, A. J., Zetsche, B., Shalem, O.,... -
Sequencing Primers
TypeGuide... forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LucNrev...virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE ... forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors...vectors, reverse primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE ... -
Chemogenetics Guide
TypeGuide...intracellular region of a turkey erythrocyte β-adrenergic receptor with a rat M3 muscarinic receptor. This... al., 2007 rM3D Rat M3 muscarinic & turkey β1-adrenergic G αs CNO* Increase cAMP Neuronal burst firing...VChR1 CTZ Na + , K + influx Neuronal activation Berglund et al., 2016 LMO7 mNeonGreen-eKL9h VChR1 CFz Na...68. PMID: 17360345 (Link opens in a new window) Berglund K, Clissold K, Li HE, Wen L, Park SY, Gleixner...Liggett SB (2001). Modification of the beta 2-adrenergic receptor to engineer a receptor-effector complex... -
Optogenetics Guide
TypeGuide...thus expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated...Optogenetics Resource Center Boyden ES, Zhang F, Bamberg E, Nagel G, Deisseroth K. 2005. Millisecond-timescale... -
Gamma-Retroviral Vector Guide
TypeGuide...LaFave, M. C., Varshney, G. K., Gildea, D. E., Wolfsberg, T. G., Baxevanis, A. D., & Burgess, S. M. (2014...Schnierle, B. S., Stitz, J., Bosch, V., Nocken, F., Merget-Millitzer, H., Engelstädter, M., Kurth, R., Groner... -
Lentiviral Vector Guide
TypeGuide... Pelayo, A., Shah, N. N., Kochenderfer, J. N., Norberg, S. M., Hinrichs, C., Highfill, S. L., Somerville...D. M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered... -
Guide to Using Pooled Libraries
TypeGuide...CRISPR library. Apply pooled library to cells. DIVERGE: Positive and negative screens POSITIVE screen:... -
Molecular Biology Reference
TypeGuide...i.e., smaller) DNA fragments. In 1952, Joshua Lederberg coined the term plasmid, in reference to any extrachromosomal... -
Antibody Guide
TypeGuide...against parasites and is responsible for driving allergic reactions such as anaphylactic shock Monomer with...