... types of proteins. They started with another biological workhorse, Cre recombinase, which induces recombination...

...Biodesign institute developed a 3’UTR database specifically for C. elegans. This database provides detailed...

... not schematized. Sizes of fragments are not to scale. Figure and caption from McGee et al., 2024, used...

...reacts with antibodies, so thorough washing is critical. Assess the stripping Now it’s time to check ...

...s outer membrane and allows the components to physically enter the cells so they can go to work. ...

...-humanized (Plasmid #44246) Expression of a catalytically inactive (dead), human codon-optimized Cas9 ...

...and Change in Undergraduate Biology Education: A Call to Action, Washington, DC. 2. President's Council...

...Hematopoietic Stem Cells. Molecular Therapy - Methods & Clinical Development 9:390–401 . https://doi.org/10.1016...

...cytoplasm or pronucleus of the zygote which is both technically challenging and can negatively impact zygote ...

...downstream of the gene to be transcribed, and typically occur directly after any 3’ regulatory elements...

...,000 colonies, but some bacteria, including E. faecalis and P. mirabilis, had only ~1 transfer per 1,000,000...

...:  my undergrads were different people! More specifically, they had different learning styles. One was...

...analysis of bisphenol A-induced perturbation in biological processes in ER-negative HEK293 cells." PLoS ...

...Addgene. 2. Dalvai, Mathieu, et al. (2015). “A Scalable Genome-Editing Based Approach for Mapping Multiprotein...

... useful also. There is also a U.K. organization called Athena SWAN that is a charter for advancing women...

...antibiotic-containing agar. This protocol will focus specifically on selection with carbenicillin; however it ...required for effective over-agar selection has been empirically determined. See selection curve below. Carbenicillin...

...microfuge tube. Using a scale, weigh the tube with the gel fragment after zeroing the scale with an empty tube...

...materials to a particular temperature, catalyze chemical reactions such as restriction digests needed in...sure to use a marker that is also resistant to chemicals such as ethanol. Writing on the tops of the tubes...

...plants: Lots of plants produce lots of seeds. I typically use 8-10 plants per construct I transform. More...

...-up Setting up colony PCR reactions is nearly identical to preparing a standard PCR reaction: combine ...

...Updated Aug 13, 2020. Note: Cpf1 is also called Cas12a. In 2015, Zetsche et al. added to the CRISPR ...

...2,500 protocols covering a variety of bio and biomedical topics. Protocol Online Website: http://www.protocol-online.org...

...2021 | Third Edition About This eBook covers practical experimental advice such as tips for planning ... on FRET, biosensors, and monitoring protein localization; an introduction to non-protein fluorophores...First Edition About Our newest eBook contains practical introductions and helpful tips for antibody-based...

...culture Aseptic Technique Aseptic technique is a critical skill for success in numerous fields such as microbiology... AAV Titration by qPCR Use qPCR to measure the physical titer of your adeno-associated virus preparation...

...community is supply chain shortages. When flasks, conical tubes or pipette tips are backordered for months...

...the attB, P, L and R sites that recombine very specifically and directionally: attB1 sites react only with...

...Melatonin for the Timing of Nocturnal Courtship Vocalization. The video summarizes the research of Drs. Feng...

...Genome-Scale, Knockout Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional...plasmid, think of each cell carrying it as being a biological replicate for that plasmid. Library screens can...

...mounting medium Laboratory wipes 15 mL conical tubes 50 mL conical tubes Before Starting Refer to the manufacturer's...

...integrate into the genome. This is important because local chromatin structure at the site of genome integration...most suitable virus for therapeutic applications. Clinical trials using AAV for various gene delivery applications...19, termed AAVS1. Instead, the rAAV genome is typically processed into a double-stranded circular episome...

...focus or zoom on a camera lens without having to physically rotate the rings around the lens. It allowed ...

...frequency three orders of magnitude higher than identical targeting vectors delivered through transfection...

...had been more careful. 3. Tell a story We are biologically programmed to listen and remember better when...

...genes are signified with a minus sign (-) as is typically standard; just having the gene listed indicates...

... using, you will be rotating dials behind the numerical display or the top of the plunger of the pipette... to pipette, it’s important for scientists to calibrate their pipettes to make sure that they are properly...

...natural and engineered repressible promoters. Chemically repressible promoters Tet-Off In its native context...

...trendline for the standards. Google Sheets can calculate this for you as follows: In the Chart Editor ,...based on your sample’s HC + LC area. Example calculation: If the sample HC + LC Area is 18179.442 and ...

...the pellet. Air-dry the pellet for 5-10 minutes. Critical It is important to not let the pellet get too ...

...transiently. Are adenoviruses replication deficient? Typically yes, because the early genes necessary for replication...for generation of recombinant adenoviruses: A Practical Guide for using the AdEasy™ System (127 KB) . ...

...IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector, forward primer...LacZ, reverse primer LexA CGTCAGCAGAGCTTCACCATTG (Caldwell lab) 3' end of LexA DNA binding domain, forward...