Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 508 results for: Trac

Showing: 501 - 508 of 508 results

  1. Adenovirus Guide

    Type
    Guide
    ...recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — containing the transgene of interest and both...multiple shuttle plasmids for different purposes. The pAdTrack series contains an IRES-GFP construct that enables...transgene of interest. With these plasmids, one can track the infection of HEK293/HER911 cells throughout ...into the host genome. Instead, they remain as extrachromosomal elements within the nucleus, normally as double-stranded...lacks E1, E3, and E4. Useful for larger inserts. pAdTrack Class of shuttle/transfer vectors for recombinant...

  2. Molecular Biology Reference

    Type
    Guide
    ...coined the term plasmid, in reference to any extrachromosomal heritable determinant. Plasmids are fragments...fragments can be inserted. When a plasmid exists extrachromosomally in E. coli , it is replicated independently...shaped bacteria naturally found in the intestinal tract of animals. There are many different naturally occurring.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL *Note: Carbenicillin can be...

  3. CRISPR Guide

    Type
    Guide
    ...dynamic tracking of repetitive and non-repetitive genomic loci, chromosome painting, and RNA tracking in living...editing can specify a single mutation, even within a tract of identical bases. Browse Plasmids: Prime Edit ...proteins that target RNA instead of DNA enables tracking of RNA in live cells, including orthogonal RNA...synthetic fusion of the endogenous bacterial crRNA and tracrRNA that provides both targeting specificity and scaffolding...

  4. Guide to Using Pooled Libraries

    Type
    Guide
    ...Functional Screens New Tool for Lineage Tracing: The ClonTracer Library...that can be used for applications like lineage tracing or parsing the effects of expressing multiple genes...

  5. Lentiviral Vector Guide

    Type
    Guide
    ...makes lentiviral libraries popular for lineage tracing experiments and monitoring the dynamics of heterogeneous...transcription started by 5' LTR by the addition of a polyA tract just after the R sequence. WPRE in cis Woodchuck...viral packaging. cPPT in cis Central polypurine tract; recognition site for proviral DNA synthesis. Increases...

  6. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...transcription started by 5' LTR by the addition of a polyA tract just after the R sequence. WPRE in cis Woodchuck...viral packaging. cPPT in cis Central polypurine tract; recognition site for proviral DNA synthesis. Increases...

  7. Promoters

    Type
    Guide
    ...from phospholycerate kinase gene TRE Inducible Tetracycline response element promoter U6 Constitutive Human...

  8. Sequencing Primers

    Type
    Guide
    ... primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA...
Showing: 501 - 508 of 508 results