We narrowed to 538 results for: sequence
-
TypeBlog Post...are too long for rAAVs, which can only package sequences shorter than 5 kb (Hirsch et al., 2016; Hudry ...
-
Retrograde AAV viral preps
TypeCollection...and (when possible) in vivo testing, and full sequencing of the final viral vector preparation. In some... -
Caltech Systemic Capsids
TypeCollection...and (when possible) in vivo testing, and full sequencing of the final viral vector preparation. Systemic... -
Cancer and the Immune System: Deciphering the Relationship
TypeBlog Post...cell therapeutics because they can help start a sequence of immune reactions that aid in the fight against... -
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...pluripotent stem cells free of vector and transgene sequences. Science, 2009. 324(5928): p. 797-801. PubMed ... -
Antibody Validation for Flow Cytometry
TypeBlog Post...therefore necessitates careful design of RNAi sequences, confirmation of RNA knockdown by RT-qPCR, and... -
Bacterial Expression Systems
TypeCollection...interactions between proteins and specific DNA sequences. ID Plasmid Reports Reporter Mechanism Expression... -
CRISPR Pooled gRNA Libraries
TypeCollection...pooled library and the use of Next-Generation Sequencing (NGS) to confirm library representation. CRISPR... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...plasmids are plasmids which use genomic regulatory sequences — termed enhancers — to drive cell type-specific... -
Using AAV for Neuronal Tracing
TypeBlog Post... In addition, rAAV2-retro’s altered amino acid sequence might facilitate interaction with uptake or intracellular... -
Molecular Biology Reference
TypeGuide...Sanger sequencing, sometimes referred to as chain-termination sequencing or dideoxy sequencing. To understand...of its sequence to design a effective primer. Sanger sequencing chromatogram Sanger sequencing is modeled...information into the DNA sequence. Sanger sequencing results are presented as a sequencing chromatogram which...efficient and reliable sequencing method. Next Generation Sequencing Although Sanger sequencing is quick and efficient...single-stranded DNA sequence used as an initiation point for PCR amplification or DNA sequencing of the plasmid...vectors must contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The ... of interest. So how do scientists sequence DNA? Sanger Sequencing In 1975, Frederick Sanger developed... -
Plan Your Experiment
TypeGuide...perfect world, your gRNA sequence would be an exact complement to your target sequence with no homologous sites... the desired target sequence, or on-target activity. Two gRNA targeting sequences with 100% homology to... selected target sequence. Additionally, any mismatches between a given gRNA sequence and your genomic...customization Usually paired with a sequencing method Can’t provide specific sequence information alone Digital ...rare edits Many options like RNA-sequencing, Perturb-seq, deep sequencing, etc. qPCR Knockouts Activation...and the guide RNA (gRNA), the design of the gRNA sequence, and finally how to validate your genetic edit...within a very narrow window proximal to the PAM sequence Base Edit Prime Edit Generate targeted insertions... -
Guide to Using Pooled Libraries
TypeGuide... Next-Generation Sequencing Next-generation sequencing allows for parallel sequencing of millions of DNA...contains a unique gene targeting sequence, but there are multiple sequences targeting each gene in the overall...libraries contain plasmids with unique, semi-random sequences that can be used for applications like lineage... of interest. In either case, next-generation sequencing of the maxiprep DNA is recommended to verify ...nucleotide analog 6-thioguanine . Next-generation sequencing is the only way to accurately evaluate which ...in the case of a reporter) Sort “winning” cells Sequence those cells that pass (“win”) Get a list of genes...screen: Apply library Perform Next Generation Sequencing (NGS) on a control sample (no selection) In parallel... -
CRISPR Guide
TypeGuide... be any ~20 nucleotide sequence, provided it meets two conditions: The sequence is unique compared to ...(PAM) The PAM sequence (NGG) serves as a binding signal for Cas9, but the exact sequence depends on which... target, the seed sequence (8–10 bases at the 3′ end of the gRNA targeting sequence) will begin to anneal...matters. Mismatches between the target sequence in the 3′ seed sequence inhibit target cleavage, while mismatches...determined by both the gRNA sequence and the Cas9 enzyme. Ideally, a gRNA targeting sequence will have perfect ...require PAM sequences in very close proximity to the region to be edited, making the PAM sequence (NGG) limiting...target sequence in your donor DNA with a silent mutation that does not change the amino acid sequence. HDR... -
Sequencing Primers
TypeGuide...Reference Sequencing Primers Sequencing Primers Addgene has used a number of primers for sanger sequence verification...A list of sequencing primers that Addgene uses for sequence verification of deposited plasmids. Plasmid...what primers are listed under "5' sequencing primer" and "3' sequencing primer". Still not sure what primer...primers are 5′ to 3′. Commonly Used Primers Primer Sequence & Description CMV Forward CGCAAATGGGCGGTAGGCGTG...promoter, forward primer Full Primer List Primer Sequence & Description 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen...TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, forward primer Amp-R ATAATACCGCGCCACATAGC 5' ...pBluescript vector pBMN 5' GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral vector pBR322ori-F... -
Cloning
TypeGuide...all recognition sequences are removed from the final product, with no undesired sequence ("scar") retained... DNA fragments with repetitive sequences and DNA that ends in sequences that form complex secondary structues...cleave double stranded DNA (dsDNA) at specific sequence sites in the DNA. In restriction cloning, scientists...relatively cheap. They also cut specific target sequences, that range from 4 to 13 base pairs, and produce...sites can be repeated throughout a specific DNA sequence, which can make it difficult at times to identify...cloning also leaves behind a short scar in the DNA sequence and can be time consuming compared to other cloning...attB2 sites attached to the 5’ and 3’ ends of DNA sequence. This fragment can then be cloned into a gateway... -
Promoters
TypeGuide...is the DNA strand that encodes codons and whose sequence corresponds to the mRNA transcript produced. The...that is transcribed by the RNA polymerase. DNA sequences called response elements are located within promoter...Promoters are controlled by various DNA regulatory sequences including enhancers, boundary elements, insulators...template strand can initiate. The TATA box is a DNA sequence (5'-TATAAA-3') within the core promoter region...contain this TATA box. Most prokaryotes contain a sequence thought to be functionally equivalent called the...Eukaryotic promoters span a wide range of DNA sequences. It is not unusual to have several regulatory ...helps to explain how many physically distant DNA sequences can affect transcription of a given gene. The ... -
Trimmer Lab NeuroMab Collection
TypeCollection...tail sequences (κ pA), a CMV promoter for heavy chain expression, and an ER signal/leader sequence (L) ...light chain expression, and an ER signal/leader sequence (L) for translocation of the light chain across... -
Adeno-associated virus (AAV) Guide
TypeGuide...homologous recombination, when both sequences present substantial sequence overlap. Co-expression induces ... the icosahedral capsid of the virus. The ITR sequences serve as origins of replication and also act as...neurons) in response to light. The short coding sequences of channelrhodopsins, halorhodopsins, and other...these methods uses splice site donor and acceptor sequences to reconstitute the two pieces of the transgene... the 5' portion of the gene and a splice donor sequence at its 3' end, while the second vector carries... 3' portion of the gene with a splice acceptor sequence at its 5' end. When these viral vectors co-infect...DNA segment composed of multiple, repeated DNA sequences linked end-to-end. Episome Genetic element inside... -
Gamma-Retroviral Vector Guide
TypeGuide...encodes the gene of interest and contains the sequences that will be incorporated into the host cell genome... of the provirus. The U3 (unique 3’) contains sequences necessary for activation of viral genomic RNA ... repeat region. U3 in cis Unique 3’; contains sequences necessary for activation of viral genomic RNA ... vectors. R in cis Repeat region with repeated sequence. U5 in cis Unique 5'; in some newer plasmids, ...the addition of a polyA tract just after the R sequence. WPRE in cis Woodchuck hepatitis virus post‐transcriptional...