...like to use in your screen. Currently, eleven published libraries are embedded. These were kindly donated...

...495/517 nm. FITC binds to an amine on a protein, enabling the labeling of protein substrates/peptides and...

... use in mammalian systems, with the landmark publication in 2013. Since that point, it has become the ...

...the many primary research papers that have been published at this point.  In brief, some standard opsins...

...consider. If you are working off of a previously established protocol, make sure to match the growth medium...changes to UAG, RF1 function removed, improved doubling time. George Church 98564 C321.Ub-UAG-sfGFP all...

...TATGTTGGTGACTTGCCTCC 58782 cut S. pyogenes 24954249 Yamamoto BLIMP1 H. sapiens CGGATGGGGTAAACGACCCG 59724 cut S. pyogenes...be added to this table from any peer reviewed publication. To add validated gRNA sequences to our datatable...

...different techniques all bring their own advantages—and blind spots—to these questions. Each new structural insight...

...around the same time. (The papers were actually published in the same journal on the same day.) This team...

...development and application of innovative tools enabling large-scale real-time interrogation and monitoring...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ...

...short peptide linkers. Diabodies can be used for assembling protein nanostructures. Figure 2: An antibody...specific to your antibody and assay may already be published. If it is not, you’ll need to validate the antibody...

...advantage of AAV vectors is that there are well-established protocols for their production and purification...

...Experiment Web References PAM Sequences Glossary Publications CRISPR Overview Bacteria have an interesting...to check the library information and original publication to see if a library is suitable for your experiment...specified by the gRNA plus the genomic PAM sequence Publications (by topic) CRISPR basics Anders, C., Niewoehner.... D., Gross, C. A., & Rosenberg, O. S. (2019). Enabling genetic analysis of diverse bacteria with Mobile-CRISPRi...

... Lab plasmids The Zinc Finger Consortium was established to promote continued research and development...

...efforts within the KLF community have lead to the establishment of this shared resource on Addgene. If you have...

...encourages its funded scientists to make their published materials and resources available to academic ...

...systems. Mammalian ID Plasmid Gene/Insert PI Publication Do you have suggestions for other plasmids that...

... described in the initial Target Accelerator publications, focused on somatic variants found in lung adenocarcinoma...

...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that...

... changes. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...

... Plasmid Gene/Insert Vector Type Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...