Skip to main content
Addgene
Showing: 41 - 60 of 60 results
  1. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Christiaen p(U6a-BsaI-gRNA) 65955 Other/Tribolium castaneum BsaI none S. pyogenes Averof p(U6b-BsaI-gRNA...Bacteria BsaI yes, activate S. pyogenes Marraffini pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) 47868 Mammalian...
  2. Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells

    Type
    Blog Post
    ...Concepcion CP, Bonetti C, Vidigal JA, Han Y-C, Ogrodowski P, Crippa A, Rekhtman N, de Stanchina E, Lowe SW, Ventura...other vectors (Lukashev et al., 2016). The protein capsid encapsulating the genome is majorly composed of...Disease, Duchenne Muscular Dystrophy, Alpha1-antitrypsin deficiency (most widely used so far) or for cancer...
  3. Plasmids 101: FLEx Vectors

    Type
    Blog Post
    ... F, Doerflinger N, Calléja C, Wendling O, Chambon P, and Ghyselinck NB. A directional strategy for monitoring...and Sternson SM. 2008. A FLEX switch targets Channelrhodopsin-2 to multiple cell types for imaging and long-range...
  4. A Look Back at One Year of Plasmid Sharing for COVID-19 Research

    Type
    Blog Post
    ...1505. https://doi.org/10.1126/science.abd0826 Tong P, Gautam A, Windsor I, Travers M, Chen Y, Garcia N,...receptor for SARS-CoV. The lab also found that cathepsins play a role in SARS-CoV infection and deposited...deposited plasmids for the expression of cathepsin S, L, and B. This became a great starting point for SARS-CoV...
  5. AAVs in Retinal Gene Therapy

    Type
    Blog Post
    ... Therapy returns to centre stage. Nature Vol 526, p.351. PubMed PMID: 26469046. 6. The Forever Fix: Gene...choroideremia, X-linked retinitis pigmentosa, achromatopsia, and age-related macular degeneration are ongoing...further improve the technology: engineering of new capsid variants, designing expression cassettes to regulate...
  6. Viral Vectors 101: The Retroviral Lifecycle

    Type
    Blog Post
    ... 2304918. PubMed Central PMCID: PMC53514 Rowe, W. P., Hartley, J. W., Lander, M. R., Pugh, W. E., & Teich...transcriptase are packaged (Wu et al., 1997) inside of the capsid . This is useful for viral reproduction, and for...for reverse transcriptase (RT) is present in the capsid, as the engineered, recombinant genome is (thankfully...
  7. Important Considerations in Optogenetics Behavioral Experiments

    Type
    Blog Post
    ...(is that pun worn out yet?) your research. Derek P. Simon received his PhD in Cellular and Molecular ...drsimonsaysscience.org or follow him on Twitter @derekpsimonphd.    References 1. Stuber, Garret D., et al....derived from direct comparative analysis of microbial opsins." Nature methods 9.2 (2012): 159-172.5. Goshen ...Addgene A Primer on Optogenetics: Introduction and Opsin Delivery The Materials Science of Optogenetics Experiments...
  8. FLEx Technology and Optogenetics: Flipping the switch on gene expression with high spatial and temporal resolution

    Type
    Blog Post
    ...PMID: 31082625. Ernst, Oliver P., et al. "Microbial and animal rhodopsins: structures, functions, and molecular...Microbial rhodopsins are encoded by opsin genes, and include bacteriorhodopsins, halorhodopsins, and channelrhodopsins...al., 2017). How to get an opsin into the brain In order to express opsins within the brain, researchers... a strong promoter upstream of an opsin gene (e.g., channelrhodopsin-2, ChR2) fused to a reporter gene...induces first opsin inversion, and then lox sites excision, therefore locking the opsin into the correct... 50 years ago with the discovery of microbial rhodopsins, light-sensitive proteins that absorb photons...light (Zhang et al., 2011). What do microbial rhodopsins and neurons have in common? Neuronal stimulations...
  9. Lentiviral Guide

    Type
    Guide
    ...transgene expression. Psi (Ψ) in cis RNA target site for packaging by Nucleocapsid. RRE in cis Rev Response...The transfer plasmid contains the viral LTRs and psi packaging signal (not pictured). Unless an internal... C, Guetard D, Nerhbass U, Montagnier L, Charneau P. Cell. 2000. 101(2): 173-185. PubMed . Woodchuck Hepatitis... a lentiviral vector. Naldini L, Blömer U, Gallay P, Ory D, Mulligan R, Gage FH, Verma IM, and Trono D...lentiviral particle containing Matrix, Capsid, and Nucleocapsid components. Pol in trans Precursor protein...for example, the U6 promoter is included in the pSico plasmid to drive shRNA expression. Other features...
  10. Sequencing Primers

    Type
    Guide
    ...primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE vectors, forward... in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element, reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG...
  11. A Practical Guide to Optimizing AAV DIO and FLEx Vector Expression

    Type
    Blog Post
    ...Burger C, Gorbatyuk OS, Velardo MJ, Peden CS, Williams P, Zolotukhin S, Reier PJ, Mandel RJ, Muzyczka N (2004...short expression times, where as others, such as hSynapsin, are relatively weak and may require longer waiting...Recombinant AAV Viral Vectors Pseudotyped with Viral Capsids from Serotypes 1, 2, and 5 Display Differential...
  12. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...suitable for high throughput applications. Trepte P, et al. J. Mol. Biol. 2015. PubMed PMID: 26264872 ...Text. Seeliger MA, Young M, Henderso MN, Pellicena P, King DS, Falick AM, and Kuriyan J. Protein Sci. 2005... below:   ID Cv (Capsid) FLAG Tag Terminus 79629 (N) and 79628 (C) Cv (capsid) N and C 79633 (N...up to 120 kb) deletions in N. benthamiana and Arabidopsis. The authors found that deletion efficiency was...
  13. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...Furthermore, they find that during stress, mRNAs in P-bodies are translationally repressed whereas the nonsequestered... has developed rapid-response luciferase (firefly P. pyralis) reporter plasmids for use in high-throughput..., Adam Cohen's lab presented Archaerhodopsin 3 (Arch) as a new rhodopsin based voltage indicator for use...plasma membrane. To obtain a more sensitive channelrhodopsin actuator for triggering action potentials ...
  14. Cre-lox system

    Type
    Collection
    ...85797 pSkipFlox split Cre Pfcrt P. falxiparum Spielmann 86641 pLenti-hSynapsin-Cre-WPRE Cre hSyn Lentiviral...similar plasmids pSicoR PGK puro , pSicoR-Ef1a-mCh-Puro , pSicoR-Ef1a-mCh and pSicoR-mCh-empty Lentiviral...PI 11578 pSico Cre activates shRNA expression, removal of EGFP; See also similar plasmids pSico PGK GFP...GFP and pSico PGK puro Lentiviral Jacks 11579 pSicoR Cre turns off shRNA expression, removal of EGFP; See...inducible CAG Mammalian Cepko 13779 pRho-Cre Cre-Myc rhodopsin Mammalian Cepko 13780 pNrl-Cre Cre-Myc, Expressed...EBFP-Cre Cre-EBFP fusion; Expression in neurons. synapsin AAV Zeng 51904 paavCAG-iCre iCre CAG AAV Kim 55632...pVAX1/mTyr-Cre Cre Tyrosinase Mammalian Blank 101242 pSin wPGK-Cre low-efficiency Cre PGK Mammalian Nedivi...
  15. Chemogenetics Guide

    Type
    Guide
    ...Link opens in a new window) Chen X, Choo H, Huang X-P, Yang X, Stone O, Roth BL, Jin J (2015). The First...PMID: 25587888 (Link opens in a new window) Coward P, Wada HG, Falk MS, Chan SD, Meng F, et al. (1998)....Lee H-M, Sciaky N, Simmons A, Nonneman RJ, Huang X-P, Hufeisen SJ, Guettier J-M, Moy SS, Wess J, Caron ..., Bonaventura J, Lesniak W, Mathews WB, Sysa-Shah P, Rodriguez LA, Ellis RJ, Richie CT, Harvey BK, Dannals...Takuwa H, Hori Y, Oyama K, Ji B, Takahashi M, Huang X-P, Slocum ST, DiBerto JF, Xiong Y, Urushihata T, Hirabayashi...collection of PSAM plasmids ! LMOs Luminopsins (LMOs), or luminescent opsins, are opto-chemogenetic fusion ... enzyme generates light that activates the opsin. The opsin may excite or inhibit the neurons expressing...
  16. Optogenetics Guide

    Type
    Guide
    ... Hegemann P, Oertner TG, Wiegert JS. 2015. An improved chloride-conducting channelrhodopsin for light-... O, Fenno L, Zhang F, Hegemann P, Diesseroth K. 2011. Microbial opsins: a family of single-component tools...Beyrière F, Tsunoda SP, Mattis J, Yizhar O, Hegemann P, Deisseroth K. 2008. Red-shifted optogenetic excitation... Example: Jaws Browse Halorhodopsin plasmids . Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum...Microbial Opsin Variants Opsin Type Variant Description Peak Response Spectra (nm) Channelrhodopsins: cation...Optogenetics Plasmid Collection . Microbial Opsins Opsins are light-gated ion channels or pumps that absorb...trafficking signals to localize opsins to the cell membrane. Microbial opsins, such as those described below...
  17. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Burger C, Gorbatyuk OS, Velardo MJ, Peden CS, Williams P, Zolotukhin S, Reier PJ, Mandel RJ, Muzyczka N. Mol...genes. The short coding sequences of channelrhodopsins, halorhodopsins, and other optogenetic genes enables...included the production of synthetic capsids and the mixing of capsids/ITRs from different AAV serotypes ...required for the AAV life cycle; VP1, VP2, VP3 - capsid proteins). When constructing an AAV transfer plasmid...of AAV through pseudotyping, or the mixing of a capsid and genome from different viral serotypes. These...containing the genome of serotype 2 packaged in the capsid from serotype 5. Use of these pseudotyped viruses... Scientists have also experimented with hybrid capsids derived from multiple different serotypes, which...
  18. Immunology Research Plasmids and Resources

    Type
    Collection
    ... 2 J2, TCRGJ2 TRGJP T cell receptor gamma joining P JP, TCRGJP TRGJP1 T cell receptor gamma joining P1... External Resouces Immport : Bhattacharya S, Dunn P, Thomas CG, Smith B, Schaefer H, Chen J, Hu Z, Zalocusky...1 CREB, MGC9284 CTSB cathepsin B APPS, CPSB CTSE cathepsin E CATE CTSL1 cathepsin L1 CATL, CTSL, FLJ31037...interleukin 1 family, member 6 (epsilon) FIL1, FIL1(EPSILON), FIL1E, IL-1F6, IL1(EPSILON), MGC129552, MGC129553...FLJ31037, MEP CTSS cathepsin S MGC3886 ERAP1 endoplasmic reticulum aminopeptidase 1 A-LAP, ALAP, APPILS, ...DHQ52, IGHD727 IGHE immunoglobulin heavy constant epsilon IgE IGHG1 immunoglobulin heavy constant gamma 1...
  19. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... 74170 pVEX-CC1 DCTN1 tac ALS Trina Schroer 75437 p-AAV-sh[SNCA] SNCA U6 Parkinson's Edward Burton 75637... 12165 pSico Dnmt1 DNMT1 GFP CMV Hereditary sensory neuropathy type IE Tyler Jacks 12166 pSicoR Dnmt1 ...Rubinsztein 41846 psiCheck-ApoE3'UTR APOE SV40 Alzheimer's Sohail Tavazoie 41848 psiCheck-ApoECDS APOE Luc... Ho 102364 pSIN-PAmCherry-mSNCA-NE SNCA NE EF-1 alpha Parkinson's Shu Leong Ho 102366 pSIN-hSNCA-NE SNCA...209085 piggyBac_rtTA (4th_Gen)_SNCA_IRES_NGN2-2A-PURO_Synapsin-BirA (pEHA1623) SNCA TRE Parkinson's Vikram ...piggyBac_rtTA (4th_Gen)_SNCA-Avi_IRES_NGN2-2A-PURO_Synapsin-BirA (pEHA1628) SNCA Avi TRE Parkinson's Vikram...
Showing: 41 - 60 of 60 results