We narrowed to 232 results for: SPL;
-
TypeBlog Post...LIIbeta F 1-2 RNAi, which allows assembly of intron-spliced hpRNAs through Golden Gate cloning. Artificial ...Nevertheless, amiRNA-based RNAi experiments routinely display highly specific and robust gene silencing (following...
-
Antibodies 101: Designing Your First Flow Panel
TypeBlog Post...emission maximum. Note, you can also use the tool to display excitation spectra, which I excluded here for better...created through the actual APC-Cy7 fluorophore but displays an emission spectrum that overlaps with APC-Cy7... -
Institute for Protein Innovation
TypeCollection...platform (Link opens in a new window) based on yeast display technology (Link opens in a new window) and an ... -
Neurodegeneration Plasmid Collection
TypeCollection...Rajat Rohatgi 107855 pHBS1333 (IBB-GFP-mCherry 3E splicer)-(BFP-P2A-TDP43 G368W W385G) TARDBP CMV ALS Rajat...Rajat Rohatgi 107860 pHBS1178 (IBB-GFP-mCherry 3E splicer)-(BFP-P2A-TDP43 dCTD EcoRV) TARDBP CMV ALS Rajat... VWM disease Petr Svoboda 121165 tau exon 9-12 splicing minigene MAPT CMV Parkinson's, FTD Stefan Stamm...ALS Agnel Sfeir 169375 pET3d-SF-DCTN1-TS DCTN1 SplitFIAsH, Strep, His T7 ALS, motor neuron disease Bernd... -
CRISPR Plasmids - Prime Edit
TypeCollection... reverse transcription. The edited DNA strand displaces the unedited 5’ flap and the resulting heteroduplex... -
Worm Expression Resources
TypeCollection...ubiquitous or a tissue-specific promoter. cGAL and Split cGAL plasmids - Paul Sternberg Lab. Plasmids for... -
Troubleshooting and Optimizing a Western Blot
TypeBlog Post...membrane and gel during the transfer, while dark splotches could indicate dirty equipment, degraded or improperly...lysis Add sonication step to protein lysis Splice variants Check literature Posttranslational... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...improved peroxidase reporter, APEX2, through yeast display. APEX2 has been shown to exhibit superior performance...functional complementation between two non-fluorescent split GFP fragments. When the two fragments, expressed... -
COVID-19 Resources
TypeCollection...page. SARS-CoV-2 Pooled Libraries - Yeast surface display libraries of Spike (S) Ectodomain and RBD mutants... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TGTGTCTTCAGGTCGTTGtcaacgctggaggaatTGTGTTGCGTTCTGGTAA crispld2 TAL3232 & TAL3233 TATCAGGAGGAGCTAGAAcccaacagcactaaacCCGACGCTCCTGTCCGAA... -
Lab Safety for Biosafety Levels One and Two
TypeProtocol...station if unwanted or biohazardous materials are splashed onto your face and/or get into your eyes. Wash...shaking or mixing, which may produce aerosols or splashes. These procedures should be done underneath a ... -
Caltech Systemic Capsids
TypeCollection...strains). AAV-PHP.eC, AAV9-X1.1 and AAV1-X1 do not display strain-specific tropism and can be used in LY6A-nonpermissive... -
CRISPR Pooled gRNA Libraries
TypeCollection...Knockout Human Olzmann 3rd ~10 13,920 Human lncRNA Splicing-targeting CRISPR Library 119977 Knockout Human... -
AAV Production in HEK293 Cells
TypeProtocol... of PEG solution to each 100 mL of supernatant. Split into 2 x 500 mL sterile bottles as needed. Add stir...cells were imaged with a 10X objective and were split 2 days before these images were taken. Last reviewed... -
2018 #DeckTheLab Contest Winners
TypeBlog Post...More #agarart from our lab @SILS_UvA 🧬🧫 Soon on display @Micropia! #SciArt #MerryChristmas #happyholidays2018... -
Congratulations, Deck The Lab winners!
TypeBlog Post...Dr. Anne Madden created a microbe advent tree displaying over 25 archaea, bacteria, fungi, and viruses... -
The Developmental Studies Hybridoma Bank: Over 25 Years of Antibody Sharing
TypeBlog Post...cells are fused with activated B cells from the spleen of mice injected with the antigen of interest. ... -
MassBioEd Career Exploration Day at Addgene
TypeBlog Post...about careers at Addgene Afterwards, the students split into two groups for an in-depth look at some of ... -
Keeping Up With CRISPR/Cas9
TypeBlog Post...important advance was quickly followed by even splashier news: Jiahao Sha of Nanjing Medical University... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Expression pBAD/His-B-iRFP - Bacterial Expression iSplit 690 713 5 Dimer pPAS-E - Mammalian Expression pK-GAFm... -
Designer PUF Proteins for Any RNA Target
TypeBlog Post... lend them many other functions for use in RNA splicing, imaging, and more. Abil says she is currently... -
Editor's Choice, September 2016
TypeBlog Post...Pharmaceuticals. This post highlights a rare disease, Fibrodysplasia ossificans progressiva (a.k.a. FOP), that, ... -
Six Spooky Science Stories and Halloween at Addgene
TypeBlog Post...the eyestalk and transform them into a pulsating display imitating a moving caterpillar. The worm controls... -
Searchable and Sortable gRNAs for Your Next CRISPR Experiment
TypeBlog Post...visualize, nick, purify, tag, scaffold, CRISPR-display, and dCas9-FokI. This table is both sortable and... -
Seeing Red: Simple GFP Photoconversion
TypeBlog Post...from other commonly used FPs, and GFP does not display auto-photoconversion as do some FPs. "While this... -
Inside Addgene's 10 Year Anniversary Gala
TypeBlog Post...Biology, I would stop by later this year when it is displayed!).  The Addgene themed music playing all night... -
Same Addgene, New Look - Why We Redesigned Our Homepage & Mascot
TypeBlog Post...concentrated on what our homepage actually said, how we displayed unique content, and made a commitment to reinforcing... -
Working 9-5: an Addgene Co-op
TypeBlog Post...was relieved to find out that the two hours were split up between several Addgene employees, who all made... -
New Norepinephrine Indicators: nLightG and nLightR
TypeBlog Post...over dopamine. All three sensors, however, did display some reaction to high concentrations of dopamine... -
A Better Way to Get Customer Support: The Help Center
TypeBlog Post...right corner of each page there’s a blue icon displaying the word “Help” next to an encircled question... -
Cre-ating New Methods for Site-specific Recombination in Drosophila
TypeBlog Post..., Dre recombinase, the close relative of Cre, displayed an excision efficiency of only 70%. To determine... -
New CRISPR Web Resources and #12DaysofCRISPR Recap
TypeBlog Post...degrades only the specified RNA target. Bonus: It displays similar on-target activity to siRNA, but with ... -
Fluorescent Proteins 101: Fluorescent Biosensors
TypeBlog Post...flame GECO biosensors from Robert Campbell’s lab display calcium-dependent increases in fluorescence of ... -
SunTag and Fluorescent Imaging
TypeBlog Post...creating v4 SunTag. Since the v4 system does not display protein aggregation, it’s recommended for most ... -
Cellosaurus: A Cell Line Information Database
TypeBlog Post...lines without a certified origin (you know, that split you got from the graduate student down the hall ... -
Genetically-encoded Sparse Cell Labeling - A SPARC of Innovation
TypeBlog Post...References: del Valle RodrĂguez A, Didiano D, Desplan C (2011) Power tools for gene expression and clonal... -
The Open Repository of CRISPR Screens: CRISPR Screen Data in One Place
TypeBlog Post.... Clicking on the screen name takes users to a display page with the relevant metadata and the screen ... -
Running for Rare Disease, Running for FOP, Running for AJ
TypeBlog Post...-old boy named AJ Gonzales who suffers from Fibrodysplasia ossificans progressiva (AKA FOP). This terrible... -
Addgene at the ASM Microbe 2016 Conference
TypeBlog Post...photos of the Agar Art competition entries were displayed in a gallery on the second floor (I loved the ... -
Validated gRNA Sequences
TypeCollection...GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens GCCCAGCCTCCGCACCTACA... -
Identifying Sequence Elements with SnapGene's Feature Database
TypeBlog Post...ability to annotate a raw plasmid sequence and display frequently used genes and control elements. Development... -
Single-cell tracking of lineage and identity with CellTag
TypeBlog Post...tagging two cell populations in a competitive transplant assay in the mouse intestine, demonstrating its... -
Bright Monomeric Fluorescent Proteins: mNeonGreen, mTFP1, and mWasabi
TypeBlog Post...with a 445/30 nm excitation filter, a 470 nm beamsplitter, and a 495/30 nm emission filter. This combination... -
Why Add Sucrose? Improved Yields for Adeno-associated Virus Preparation
TypeBlog Post...sucrose or other osmolytes to induce hypertonicity display enhanced monoclonal antibody production (Oyaas,... -
Viral Vectors 101: What is a Virus (and a Viral Vector)?
TypeBlog Post...replication process whereby one cell copies itself and “splits” into two cells. Viral vectors Viruses are quite... -
What the HEK?
TypeBlog Post... fibroblast. However, Frank Graham showed HEKs display many immature neuron-like qualities, which is inconsistent... -
Hot Plasmids and Viral Preps - September 2021
TypeBlog Post...disrupt gene function by targeting start codons, splice acceptor and donor sites, and introducing premature... -
Three Tips for Preventing Viral Plasmid Recombination in Your Samples
TypeBlog Post... it recombines at the 5’ and 3’ LTR regions, it splits into two smaller plasmids. The ~3.7 kb recombined... -
Summer SciComm Series: Master of SciComm
TypeBlog Post...illustrate the breadth of knowledge and passion on display in our building, each day brushing past and chatting... -
Hot Plasmids September 2018 - Optogenetics, RNA Localization, Fluorescent Protein, and Base-editing Tools
TypeBlog Post...involved in their growth and extension. Now, they split EB1 into two halves (Fig. 1): one containing the...