Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 68 results for: CMV

Showing: 41 - 60 of 68 results

  1. CRISPR References and Information

    Type
    Collection
    ...packaging plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF, 2.4 MB Zhang GeCKO pooled library amplification...packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Pooled libraries are also available for human...

  2. Sequencing Primers

    Type
    Guide
    ... Commonly Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC...AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward primer Luc-F AGTCAAGTAACAACCGCGA...MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer...

  4. Lentiviral Vector Guide

    Type
    Guide
    ...chimeric 5’ LTR fused to a heterologous promoter (often CMV or RSV), eliminating the need for transactivation...fused to a heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between... LTRs and replaced with a heterologous promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter...hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription started..., including: Lymphocytic Choriomeningitis Virus (LCMV) – less toxic and inflammatory; targets wide range...

  5. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...and replaced with a heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter...hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription started...

  6. Plan Your Experiment

    Type
    Collection
    ... vector Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter...

  7. Caltech Systemic Capsids

    Type
    Collection
    ...CAG NLS-GFP Control Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Control Wilson 105547 pENN.AAV....

  8. Promoters

    Type
    Guide
    ...Used in Research Promoter Expression Description CMV Constitutive Strong mammalian promoter from human...

  9. Plan Your Experiment

    Type
    Guide
    ... vector Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter...

  10. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...be used with packaging plasmid pCMV-dR8.2 dvpr and envelope plasmid pCMV-VSVG from Robert Weinberg’s lab...Note: pLKO.1 could also be packaged using pCMV-dR8.2 dvpr and pCMV-VSVG from the Robert Weinberg lab. For...

  11. 15 Years of Addgene: The Top 15 Plasmids

    Type
    Blog Post
    .... Find pSpCas9(BB)-2A-Puro (PX459) V2.0. pCMV-VSV-G - pCMV-VSV-G was deposited by the Bob Weinberg lab.... It can be used with packaging plasmids such as pCMV-dR8.2 dvpr (lentiviral) or pUMVC (MuLV retroviral..., this plasmid predates Addgene’s founding. Find pCMV-VSV-G. pRSV-Rev - This 3rd generation lentiviral...

  12. Export Control Regulations Lifted for Plasmids Containing Rabies and VSV-G Genes

    Type
    Blog Post
    ...VSV-G Plasmids Name Purpose Depositing Lab pCMV-VSV-G (Empty Backbone) Envelope protein for producing...Use in conjunction with a packaging vector such as pCMV-dR8.2 dvpr (lentiviral) or pUMVC (MuLV retroviral...pseudotyping NanoMEDIC particles Akitsu Hotta pHCMV-RabiesG Contains Rabies virus G protein; see depositing...

  14. Pooled Library Amplifications

    Type
    Blog Post
    ... Protoc. 2017 with modifications Screening pCMV-Rep78/68 Scanning Saturation Mutagenesis (SSM) Pooled...1866 bp, plus a 20 bp barcode 400 ng Solid pCMV-Rep 78/68 SSM Library Amplification and Sequencing...

  15. New Viral Vectors - Spring 2025

    Type
    Blog Post
    ...Biosensor GENIE Project New serotype pENN.AAV.CMVs.Pl.Cre.rBG AAV5 Recombinase James M. Wilson New serotype...

  16. New Viral Vectors - March 2024

    Type
    Blog Post
    ...Chemogenetics Deisseroth New viral vector pAAV.CMV.PI.EGFP.WPRE.bGH  AAV PHP.eB Controls Wilson New viral ...

  19. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...(green) and heavy (blue) chains as driven by two CMV promoters (orange). Hybridoma-derived V L and V H...the κ light chain polyA tail sequences (κ pA), a CMV promoter for heavy chain expression, and an ER signal...into the p1316 plasmid that contains an upstream CMV promoter for light chain expression, and an ER signal...
Showing: 41 - 60 of 68 results