Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 41 - 50 of 50 results
  1. A New Optogenetic Tool Based on AraC Controls Gene Expression with Blue Light

    Type
    Blog Post
    ... strain transformed with pBLADE expressing superfolder GFP instead of mCherry under the PBAD promoter....the DNA-binding domain of AraC using a mCherry reporter downstream of a PBAD promoter. While none of the...contains BLADE, the PBAD promoter, and a mCherry reporter downstream of the PBAD promoter. To use this plasmid...
  2. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They...-ome using a quick, affordable, and ubiquitous reporter assay. In their recent publication, Kroeze et ...with unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many ... different human cell models and identified ~4-5-fold more fitness-related genes than have been found ... of DsRed connected to a pH-sensitive variant of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The...when it is difficult for a cell to synthesize or fold a protein because of its length. Mark Howarth’s ...endogenous proteins. As described in their recent Cell Reports paper, the Kanemaki lab overcame this hurdle using...
  3. CRISPR 101: Targeting RNA with Cas13a (C2c2)

    Type
    Blog Post
    ... using a superfolder GFP fusion to stabilize the protein in mammalian cells. LwaCas13a-msfGFP can mediate...of interest and an inactivated fluorescent RNA reporter. If the target sequence is present in the pool...activity of Cas13a becomes activated and the RNA reporter will be cleaved resulting in activation of the...
  4. Neurodegeneration Research Collection

    Type
    Collection
    ... S A. 2023 Aug 22. Use a lentiviral FRET-based reporter to study tau seeding in mammalian cells. Lathuiliere...Cre-dependent expression of diphtheria toxin receptor (DTR)–GFP fusion protein. Azim et al. Nature. 2014 Apr 17. ... (AIS) plasticity with a motor neuron-specific reporter and a PAX7 inducible vector . Harley et al. Cell.... These glutamine-rich sequences are prone to misfolding and aggregation and can interfere with protein-protein...
  5. CRISPR 101: Multiplex Expression of gRNAs

    Type
    Blog Post
    ...destination vector contains GFP, enabling you to select cells with high GFP expression. These cells have...plasmids, which contain various promoters and reporters, and subsequently inserted into a Cas9-containing...-in-one CRISPR/Cas9 vector system.” Scientific Reports 4 (2014): 5400. PubMed PMID: 24954249. PubMed Central...vectors containing the U6 promoter and the gRNA scaffold are provided with the kit. Oligonucleotides specifying...
  6. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...
  7. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ....1 showed the greatest fold change in RNA and DNA levels (~25-fold and ~4-fold respectively) relative ...expression from mouse to primate neocortex. Cell Reports, 34(13). https://doi.org/10.1016/j.celrep.2021.108754...relatively even distribution of target gene expression (EGFP, in the depositing manuscript) across the brain....
  8. CRISPR Guide

    Type
    Collection
    ...is typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells,... separate transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich...inactive dCas9 fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable...The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-... complex through interactions between the gRNA scaffold and surface-exposed positively-charged grooves...or co-expression of dCas9-VP64 with a modified scaffold gRNA and additional RNA-binding helper activators...activators have been developed for bacteria by using a scaffold RNA that contains the gRNA and an RNA hairpin ...
  9. Optogenetics Guide

    Type
    Guide
    ...optical switches Sensors are genetically-encoded reporters of molecular signals; e.g., calcium indicators...plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ, ePDZb and ePDZb1 as tags. pDawn/pDusk...photoswitch. Illumination causes the photoswitch to unfold, lowering the toxin's local concentration near ...
  10. CRISPR Guide

    Type
    Guide
    ...is typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells,... separate transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich...inactive dCas9 fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable...The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-... complex through interactions between the gRNA scaffold and surface-exposed positively-charged grooves...or co-expression of dCas9-VP64 with a modified scaffold gRNA and additional RNA-binding helper activators...activators have been developed for bacteria by using a scaffold RNA that contains the gRNA and an RNA hairpin ...
Showing: 41 - 50 of 50 results