We narrowed to 57 results for: eomes
-
TypeBlog Post... tagging as a sensitive reporter for tracking proteomic cargo flow via EVs. Find ADAR-HiBiT Fusion Vector...
-
Mycoplasma Contamination: Where Does It Come From and How to Prevent It
TypeBlog Post...https://doi.org/10.1290/1071-2690(2002)038<0086:caeomi>2.0.co;2 Uphoff CC, Drexler HG (2011) Detecting... -
Cancer and the Immune System: Deciphering the Relationship
TypeBlog Post...Furthermore, tumor cells alter their cell-surface proteome to inhibit expression of co-stimulatory molecules... -
Plant Plasmids and Resources
TypeCollection...Maize Transcription Factor ORFeome - John Gray. Rice Transcription Factor ORFeome - John Gray. Plant transcription... -
Lentivirus Plasmids
TypeCollection...with puromycin selection. See plasmid 21916 for neomycin selection. Dmitri Wiederschain 11578 pSico 3rd...Tet-pLKO-neo 3rd Inducible expression of shRNA with neomycin selection. See plasmid 21915 for puromycin selection... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Organism Representative Empty Backbones Neomycin (G418) Mammalian, Varies Tet-pLKO-neo - Tet-inducible...selection Find nematode transgenesis plasmids with Neomycin selection Puromycin Mammalian pcDNA3.1-(-)-Pur... -
Antibody Guide
TypeCollection...done using methods such as transcriptomics or proteomics. This approach is often appropriate for quantitative...validation This method uses peptide identification by proteomics (Capture MS) to validate the identity of proteins... -
Resolute Plasmid Collection
TypeCollection...core of the deorphanizing engine. Genetic and proteomic interactions represent the framework that provides... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...reporter vector expressing firefly luciferase with neomycin resistance. Christopher Vakoc 138152 pLentiEGFPdestablized... -
Retrovirus Plasmids
TypeCollection... for puromycin selection, and plasmid 1774 for neomycin selection. Bob Weinberg 10676 pMKO.1 GFP MoMLV... -
CRISPR Plasmids - Plants
TypeCollection... As Cpf1 Qi 91715 pKEE401 yes, cut S. pyogenes Neomycin Chen Do you have suggestions for other plasmids... -
CRISPR References and Information
TypeCollection...cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2... -
Luciferase Plasmid Collection
TypeCollection...destabilized mutants which serve as sensors of proteome stress. pHLuc : An extracellular pH sensor consisting... -
Tetracycline Inducible Expression
TypeCollection...with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri Wiederschain 85966... -
Sequencing Primers
TypeGuide...CGTTGGCTACCCGTGATATT 3' end of neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance ... -
Antibody Guide
TypeGuide...done using methods such as transcriptomics or proteomics. This approach is often appropriate for quantitative...validation This method uses peptide identification by proteomics (Capture MS) to validate the identity of proteins... -
Optogenetics Guide
TypeGuide...Red-shifted chloride-conducting channel from Proteomonas sulcata 540 Phobos Blue-shifted iC++ variant ...