Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 589 results for: Ret;

Showing: 581 - 589 of 589 results

  1. Modular Cloning Guide

    Type
    Guide
    ...) to optimize secretion and cell surface display of proteins of interest. Yeast Secrete and Detect Yeast...Penicillium or Aspergillus species. MoClo Yeast Secretion and Display (YSD) Toolkit Yeast Expression Paul...Plasmids to generate transcription units for protein secretion in yeasts S. cerevisiae and P. pastoris (a.k.a... MoClo-YTK toolkit for protein expression and secretion in P. pastoris (a.k.a. K. phaffii ). GoldenPiCS...RBS strength variants, 8 tag-compatible RBSs, 2 secretion tags, 6 CDSs, 9 terminators, 4 nonfunctional "...

  2. CRISPR Guide

    Type
    Guide
    ...coding sequence ~1 kb shorter than SpCas9 while retaining the same basic function. Its size allows it to...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...Cas9 Fusion Tools dCas9 cannot cleave DNA, but it retains the ability to find specific DNA targets through...specificity, and editors carrying an ADAR truncation that retain RNA editing capabilities but are small enough to...23979020 Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W.,...., Terns, M. P., White, M. F., Yakunin, A. F., Garrett, R. A., Van Der Oost, J., . . . Koonin, E. V. (...: 32572269 Charpentier, M., Khedher, A. H. Y., Menoret, S., Brion, A., Lamribet, K., Dardillac, E., Boix...

  3. Molecular Biology Reference

    Type
    Guide
    ...plasmids through cell division. To ensure the retention of plasmid DNA in bacterial populations, an antibiotic...these conditions, there is a selective pressure to retain the plasmid DNA, despite the added replication ...to create viral particles, such as lentiviral, retroviral, AAV, or adenoviral particles, that can infect...

  4. Antibody Guide

    Type
    Guide
    ... Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears, saliva, mucus) where it protects... your samples using permeabilization, antigen retrieval, and/or sectioning. Block to reduce non-specific...upwards of twenty. Laser and software capacity theoretically allow for roughly fifty different fluorophore...

  5. Cloning

    Type
    Guide
    ...final product, with no undesired sequence ("scar") retained. A disadvantage of type IIS assembly cloning systems...restriction site. Because of the relatively long stretches of base pairing in the annealed product, ligation...

  6. Chemogenetics Guide

    Type
    Guide
    ...chemogenetic access to optogenetic tools, they also retain the ability to be activated by standard optogenetics...chemogenetic control in a single molecule driven by FRET-modified bioluminescence. Neurophotonics. 11:021005...

  7. Science Guides

    Type
    Guide
    ...Lentivirus Adeno-associated Virus (AAV) Adenovirus γ-Retrovirus Read More...

  8. Addgene's eBook Collection

    Type
    Guide
    ...for choosing a fluorescent protein; information on FRET, biosensors, and monitoring protein localization...

  9. Sequencing Primers

    Type
    Guide
    ...GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral vector pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322...
Showing: 581 - 589 of 589 results