We narrowed to 586 results for: ret
-
TypeGuide... Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears, saliva, mucus) where it protects... your samples using permeabilization, antigen retrieval, and/or sectioning. Block to reduce non-specific...upwards of twenty. Laser and software capacity theoretically allow for roughly fifty different fluorophore...
-
Cloning
TypeGuide...final product, with no undesired sequence ("scar") retained. A disadvantage of type IIS assembly cloning systems...restriction site. Because of the relatively long stretches of base pairing in the annealed product, ligation... -
Chemogenetics Guide
TypeGuide...chemogenetic access to optogenetic tools, they also retain the ability to be activated by standard optogenetics...chemogenetic control in a single molecule driven by FRET-modified bioluminescence. Neurophotonics. 11:021005... -
Science Guides
TypeGuide...Lentivirus Adeno-associated Virus (AAV) Adenovirus γ-Retrovirus Read More... -
Addgene's eBook Collection
TypeGuide...for choosing a fluorescent protein; information on FRET, biosensors, and monitoring protein localization... -
Sequencing Primers
TypeGuide...GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral vector pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322...