Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Showing: 1 - 11 of 11 results
  1. Retrovirus Guide

    Type
    Guide
    ...Glossary γ-Retroviral Packaging Systems The widespread use of γ-retroviruses (gamma-retroviruses) in cancer...pseudotyping. Retroviral Packaging Methods Return to Top Frequently Asked Questions (FAQ) about γ-Retroviral Plasmids... Overview of Retroviral Plasmid System Note : While both lentiviruses and γ-retroviruses use the same ...MoMLV and MSCV for γ-retrovirus; HIV for lentivirus). Additionally, γ-retroviruses can only transduce dividing... Are γ-retroviruses self-inactivating (SIN)? They can be. Plasmids that encode SIN γ-retrovirus lack most...Guide to retroviral packaging systems and commonly asked questions Guides... Guides γ-Retrovirus Guide γ-Retrovirus...
  2. Lentiviral Guide

    Type
    Guide
    ...between a lentivirus and a retrovirus? Lentiviruses are a subtype of retrovirus. From an experimental standpoint...difference between lentiviruses and standard retroviruses (γ-retroviruses) is that lentiviruses are capable of...variety of cell types than retroviruses. Both lentiviruses and standard retroviruses use the gag, pol, and ...heterologous enhancer/promoter such as CMV or RSV Return to Top Viral Production The process of producing...actively dividing cell types whereas standard retroviruses can only infect mitotically active cell types...lentivirus may not be efficiently packaged by retroviral packaging systems, and vice versa. Which bacterial...stable cell lines in the same manner as standard retroviruses. That is, many lentiviral genomes have selectable...
  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...gene delivery applications are currently underway. Return to Top Viral Integration As part of its lysogenic...AAV8 Photoreceptor Cells AAV2, AAV5, AAV8 RPE (Retinal Pigment Epithelium) AAV1, AAV2, AAV4, AAV5, AAV8...AAV8 Skeletal Muscle AAV1, AAV6, AAV7, AAV8, AAV9 Return to Top AAV Pseudotyping Researchers have further...enabling the development of further AAV applications. Return to Top Additional Resources AAV Plasmids Available...Engelhardt JF. Mol Ther. 2001 Oct;4(4):383-91. PubMed . Return to Top...
  4. CRISPR Guide

    Type
    Guide
    ...and HNH. Cas9 nickase, a D10A mutant of SpCas9, retains one nuclease domain and generates a DNA nick rather...editors carrying the delta-984-1090 ADAR truncation retain RNA editing capabilities and are small enough to...that cannot cleave target DNA. The dCas9 molecule retains the ability to bind to target DNA based on the ...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...homology-dependent repair. 2018. Charpentier M, Khedher AHY, Menoret S, Brion A, Lamribet K, Dardillac E, Boix C, Perrouault... FJ, Terns RM, Terns MP, White MF, Yakunin AF, Garrett RA, van der Oost J, Backofen R, Koonin EV. Nat ...Cas systems. 2013. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini ...
  5. Molecular Biology Reference

    Type
    Guide
    ...plasmids through cell division. To ensure the retention of plasmid DNA in bacterial populations, an antibiotic...these conditions, there is a selective pressure to retain the plasmid DNA, despite the added replication ...to create viral particles, such as lentiviral, retroviral, AAV, or adenoviral particles, that can infect...
  6. Antibody Guide

    Type
    Guide
    ... Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears, saliva, mucus) where it protects... your samples using permeabilization, antigen retrieval, and/or sectioning. Block to reduce non-specific...upwards of twenty. Laser and software capacity theoretically allow for roughly fifty different fluorophore...
  7. Adenovirus Guide

    Type
    Guide
    ...do not contain E4. Adenovirus Packaging Methods Return to Top Frequently Asked Questions (FAQ) about Adenoviral...Receptor used by Ad5-based vectors to enter cells Return to Top...
  8. Cloning

    Type
    Guide
    ...final product, with no undesired sequence ("scar") retained. A disadvantage of type IIS assembly cloning systems...restriction site. Because of the relatively long stretches of base pairing in the annealed product, ligation...
  9. Science Guides

    Type
    Guide
    ...Lentivirus Adeno-associated Virus (AAV) Adenovirus γ-Retrovirus Read More...
  10. Addgene's eBook Collection

    Type
    Guide
    ...for choosing a fluorescent protein; information on FRET, biosensors, and monitoring protein localization...
  11. Sequencing Primers

    Type
    Guide
    ...GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral vector pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322...
Showing: 1 - 11 of 11 results