Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 819 results for: cell

Showing: 741 - 760 of 819 results

  1. Sequencing Primers

    Type
    Guide
    ...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...

  3. Career Insights: Technical Support Specialist

    Type
    Blog Post
    ...issue was with a custom-made reagent to manipulate cells (manufactured by one of the larger biotech companies...Specifically, roles in technical support make excellent use of the skills developed by life science PhDs...about novel developments in the fields of gene and cellular therapies.     Additional Resources on the Addgene...

  7. Light Sheet Fluorescence Microscopy

    Type
    Blog Post
    ... Weber, M. Mickoleit, J. Huisken. (2014) Methods Cell Biol.123, 193-215. Pubmed. W. Spalteholz. (1914)...transparent are enabling microscopes to visualize the cellular architecture of whole tissues in 3D with unprecedented...

  8. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...R-mAbs plasmids, production of R-mAbs in transfected cells and their validation can be found below. With these...transfecting the plasmids into mammalian tissue culture cells (e.g., HEK293, COS, CHO), from which the R-mAbs ...level expression we recommend using the HEK-2936E cell line engineered by Durocher et al., 2002 (Link opens...used to produce R-mAbs from transfected mammalian cells. Addgene ID Plasmid Target Target Species Host Species...Pink1 Human M. musculus (mouse) IgG2b 227033 SynCAM1 cell adhesion molecule (Mus musculus) recombinant mouse...used to produce scFvs from transfected mammalian cells. Addgene ID Plasmid Hybridoma Target Target Species...to produce nanobodies from transfected bacterial cells. Addgene ID Plasmid Hybridoma Target Target Species...

  9. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...Alternatively, gRNA-only plasmids can be used in cells or organisms in which Cas9 has been integrated into...

  11. Plasmids 101: Broad Host Range Plasmids

    Type
    Blog Post
    ...ability to establish and maintain itself within host cells.  The plasmid has multiple ori that are functionally...eutrophus, Bartonella bacilliformis, Bordetella spp., Brucella spp., Caulobacter crescentus, Escherichia coli...

  13. Using Video to Share Your Science: We Share Science

    Type
    Blog Post
    ... the 926 video abstracts identified. The journal Cell had the largest average view count per video abstract.../wesharescience.com/pin/7472 Article: http://www.cell.com/current-biology/abstract/S0960-9822(16)30873...

  14. CRISPR-mediated Plant Base Editors

    Type
    Blog Post
    ...homology-directed repair (HDR) pathway which occurs in cells at low frequencies and relies on the efficient delivery...Later the resultant U-G pair is either repaired by cellular mismatch repair machinery making an original C-G...’ to ‘I’ (inosine), which is treated as ‘G’ by cellular polymerases. Subsequently, an original genomic... is converted to a G-C pair (Figure 1). As the cellular inosine excision repair is not as active as uracil...

  15. Optogenetics AAV Preps

    Type
    Collection
    ...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...

  16. Retrograde AAV viral preps

    Type
    Collection
    ... of Cre, and expresses NLS-EGFP in Cre-positive cells. Control Brandon Harvey 137164 pAAV-nEF-Con/Fon/...

  17. The Pleiades Promoter Project

    Type
    Collection
    ...therapies for brain disorders by enabling region- and cell-specific gene-delivery in the mouse brain through...

  18. Modular Cloning Guide

    Type
    Guide
    ...assembly of cellular circuits using Golden Gate-based cloning methods for use in mammalian cells. These can...MoClo Yeast Toolkit (YTK) to optimize secretion and cell surface display of proteins of interest. Yeast Secrete... create multigene constructs expressed in the cellulose-producing Komagataeibacter species. Ralstonia-...
Showing: 741 - 760 of 819 results